zgc:103518

Ensembl ID:
ENSDARG00000021380
ZFIN ID:
ZDB-GENE-041114-27
Description:
protein phosphatase 1D [Source:RefSeq peptide;Acc:NP_001007341]
Human Orthologue:
PPM1D
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1D [Source:HGNC Symbol;Acc:9277]
Mouse Orthologue:
Ppm1d
Mouse Description:
protein phosphatase 1D magnesium-dependent, delta isoform Gene [Source:MGI Symbol;Acc:MGI:1858214]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20543 Nonsense Available for shipment Available now
sa12778 Nonsense Available for shipment Available now
sa40569 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014028 Nonsense 40 534 1 6
Genomic Location (Zv9):
Chromosome 5 (position 58333742)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 56254341
GRCz11 5 56924558
KASP Assay ID:
2259-6593.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGATTTAACGGAGGTGATCGTGGAGCTGGAACCCACCGAAGATGAGT[T/A]GCAGGCGGCGGGACACGCTGATCCAAAGCCGGACCAAGAGCCGGTCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014028 Nonsense 208 534 2 6
Genomic Location (Zv9):
Chromosome 5 (position 58331004)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 56251603
GRCz11 5 56921820
KASP Assay ID:
2259-6592.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTCATGTTGGGGAYTCATCTGTGGTTCTGGGCGTGAGGGAGGACCCCT[C/A]GGATAAGGTCATCAAAGCTGTGGAGGTCACTCAAGACCACAAGCCCGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014028 Nonsense 252 534 3 6
Genomic Location (Zv9):
Chromosome 5 (position 58330424)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 56251023
GRCz11 5 56921240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACTGTAGTGTGGTGAAGAAGTCTGGTGTGAACCGTGTGGTGTGGAAA[C/T]GACCTAGGCTAAGTCACAATGGACCGGTCAGGAGGAGCACCCCAATCGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link