
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sh3pxd2b
- Ensembl ID:
- ENSDARG00000021377
- ZFIN ID:
- ZDB-GENE-060810-52
- Description:
- Im:7155315 protein [Source:UniProtKB/TrEMBL;Acc:Q6DC19]
- Human Orthologue:
- SH3PXD2B
- Human Description:
- SH3 and PX domains 2B [Source:HGNC Symbol;Acc:29242]
- Mouse Orthologue:
- Sh3pxd2b
- Mouse Description:
- SH3 and PX domains 2B Gene [Source:MGI Symbol;Acc:MGI:2442062]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24036 | Essential Splice Site | Available for shipment | Available now |
sa9265 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37381 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24036
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031308 | Essential Splice Site | 221 | 565 | 8 | 13 |
- Genomic Location (Zv9):
- Chromosome 21 (position 42369967)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 42773473 GRCz11 21 42768764 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGGAAGCTCAAGATGATCCGGATGATTTCTCACTTCCAGCAGAAGAAGG[T/C]AAAGCCTCCTGAATAAAGCACCTGCAGCTAATATAGTATAATATTGGGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9265
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031308 | Nonsense | 262 | 565 | 10 | 13 |
- Genomic Location (Zv9):
- Chromosome 21 (position 42363276)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 42780164 GRCz11 21 42775455 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTTTAGCAGTTTCTTGGRTGGAACRTTGTCRCCTTNACCCCCACAGGTAC[C/T]AAGGGAAAGAGGGCTGGGCCCCGGCATCTTACTTGAAGAAGGCTGACATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37381
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031308 | Nonsense | 337 | 565 | 11 | 13 |
- Genomic Location (Zv9):
- Chromosome 21 (position 42362669)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 42780771 GRCz11 21 42776062 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGCTTCTTCTCTTGCAGAAGTAGGGGCACGACAGAGGCCTCCACCACGC[C/T]GAGATCTTACAATAGTAAGGGTTATAATGCTTTTACAGTTGCATGTCATA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: