actr6

Ensembl ID:
ENSDARG00000021370
ZFIN ID:
ZDB-GENE-030131-3543
Description:
actin-related protein 6 [Source:RefSeq peptide;Acc:NP_955990]
Human Orthologue:
ACTR6
Human Description:
ARP6 actin-related protein 6 homolog (yeast) [Source:HGNC Symbol;Acc:24025]
Mouse Orthologue:
Actr6
Mouse Description:
ARP6 actin-related protein 6 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914269]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38059 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003715 Nonsense 11 396 1 11
ENSDART00000146578 Nonsense 11 135 1 4

The following transcripts of ENSDARG00000021370 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 20083961)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19495938
GRCz11 25 19593889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAACTGAGATGTAAACATGTCAACGCTAGTGTTGGACAATGGCGCGTA[C/A]TTCGCTAAAATCGGGTACAGTCATGAGAAAGTCAGGTATGGTGTTTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link