
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
capg
- Ensembl ID:
- ENSDARG00000021318
- ZFIN IDs:
- ZDB-GENE-030131-8541, ZDB-GENE-030131-8541
- Description:
- capping protein (actin filament), gelsolin-like [Source:RefSeq peptide;Acc:NP_001001594]
- Human Orthologue:
- CAPG
- Human Description:
- capping protein (actin filament), gelsolin-like [Source:HGNC Symbol;Acc:1474]
- Mouse Orthologue:
- Capg
- Mouse Description:
- capping protein (actin filament), gelsolin-like Gene [Source:MGI Symbol;Acc:MGI:1098259]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13484 | Nonsense | Available for shipment | Available now |
sa42027 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa13484
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010848 | Nonsense | 128 | 345 | 4 | 9 |
ENSDART00000111677 | Nonsense | 157 | 374 | 5 | 10 |
- Genomic Location (Zv9):
- Chromosome 12 (position 23954359)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 22477720 GRCz11 12 22598939 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGTTCTGTTTGTGCAGGAGGGAGGAGTGGAGTCTGGCTTCAGAAGAGCG[C/T]AGTCTGGACCTGGACCTGTTCAGAGGTTATACCAAATCAAAGGGAAACGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42027
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000010848 | Nonsense | 163 | 345 | 4 | 9 |
ENSDART00000111677 | Nonsense | 192 | 374 | 5 | 10 |
- Genomic Location (Zv9):
- Chromosome 12 (position 23954466)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 22477827 GRCz11 12 22599046 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGGCAAAGGAAGTAGATTTGAGCTGGCAGAGCTTTAACAAGGGCGACTG[C/A]TTCATACTTGATCTGGGCGAGGTCTGTGTGTGTTGTTTGTTTCAATTTTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: