zgc:77775

Ensembl ID:
ENSDARG00000021293
ZFIN ID:
ZDB-GENE-040426-1871
Description:
Putative N-acetylglucosamine-6-phosphate deacetylase [Source:UniProtKB/Swiss-Prot;Acc:Q6P0U0]
Human Orthologue:
AMDHD2
Human Description:
amidohydrolase domain containing 2 [Source:HGNC Symbol;Acc:24262]
Mouse Orthologue:
Amdhd2
Mouse Description:
amidohydrolase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2443978]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12248 Nonsense Available for shipment Available now
sa19918 Nonsense Available for shipment Available now
sa6871 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022967 Nonsense 58 404 3 12
Genomic Location (Zv9):
Chromosome 3 (position 67631)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13391749
GRCz11 3 13541861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAGCTGTTTTTCGATGAACAGGGTTTTGCRGATCACAGAGTGGACTG[C/A]GAGAATAAAATCATTGCACCTGGATTCATAGATGTGCAACTRAATGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022967 Nonsense 107 404 4 12
Genomic Location (Zv9):
Chromosome 3 (position 64859)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13388977
GRCz11 3 13539089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCTCTGGTGGCCAAAAAGATTCTAGAACACGGTGTCACTTCCTTCTG[C/A]CCCACCCTCGTCACGTCTCCACCACACATATACCATAAGGTAAAGTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022967 Nonsense 220 404 7 12
Genomic Location (Zv9):
Chromosome 3 (position 60865)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 13384983
GRCz11 3 13535095
KASP Assay ID:
554-5438.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGTGTTTTCTCTGTCCAGGACACTCGATGGCTGATCTCTCTCAGGCT[G/T]AGGAGGCTGTGCAGAACGGAGCCACGTTCATTACACACTTATTTAACGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link