zgc:162295

Ensembl ID:
ENSDARG00000021288
ZFIN ID:
ZDB-GENE-070424-65
Description:
hypothetical protein LOC567247 [Source:RefSeq peptide;Acc:NP_001077029]
Human Orthologue:
MIER3
Human Description:
mesoderm induction early response 1, family member 3 [Source:HGNC Symbol;Acc:26678]
Mouse Orthologue:
Mier3
Mouse Description:
mesoderm induction early response 1, family member 3 Gene [Source:MGI Symbol;Acc:MGI:2442317]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41165 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15544 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061758 Essential Splice Site 170 537 6 13
Genomic Location (Zv9):
Chromosome 8 (position 17670535)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17115423
GRCz11 8 17151135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAATCTGAGGGGGAGGAGGACGGTGTAAACAGTGAAGATTCTAGAAAG[G/A]TTGGTTTTATATTATTGTTGTTATTATTATTGTTAGTGTATACTGTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061758 Nonsense 472 537 13 13
Genomic Location (Zv9):
Chromosome 8 (position 17676186)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17121074
GRCz11 8 17156786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGCTCTGACCTGGGCCAGYTCAGCATGTGCAGCASCAAAGACTGCGAA[C/T]GACCCTCCAAGAGGCTCAARATGGGCCTTTCAGAGTCCTTCATCAACGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link