zgc:91909

Ensembl ID:
ENSDARG00000021287
ZFIN ID:
ZDB-GENE-040704-16
Description:
hypothetical protein LOC431725 [Source:RefSeq peptide;Acc:NP_001002178]
Human Orthologue:
RAB7A
Human Description:
RAB7A, member RAS oncogene family [Source:HGNC Symbol;Acc:9788]
Mouse Orthologue:
Rab7
Mouse Description:
RAB7, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105068]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2453 Nonsense F2 line generated During 2018
sa13513 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2453
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004065 Nonsense 176 204 5 6
ENSDART00000124225 Nonsense 176 204 4 5
ENSDART00000004065 Nonsense 176 204 5 6
ENSDART00000124225 Nonsense 176 204 4 5
Genomic Location (Zv9):
Chromosome 8 (position 53239898)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50982423
GRCz11 8 50971445
KASP Assay ID:
554-3183.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTAATGTGGAACAGGCCTTCCAGACCATCGCTCGCAATGCGCTTAAA[C/T]AGGTAGAAGAACATYCTAGAACTGTTATTGTTGTTGTTGACGAAAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004065 Nonsense 176 204 5 6
ENSDART00000124225 Nonsense 176 204 4 5
ENSDART00000004065 Nonsense 176 204 5 6
ENSDART00000124225 Nonsense 176 204 4 5
Genomic Location (Zv9):
Chromosome 8 (position 53239898)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50982423
GRCz11 8 50971445
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTAATGTGGAACAGGCCTTCCAGACCATCGCTCGCAATGCGCTTAAA[C/T]AGGTAGAAGAACATYCTAGAACTGTTATTGTTGTTGTTGACGAAAGAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link