
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:91909
- Ensembl ID:
- ENSDARG00000021287
- ZFIN ID:
- ZDB-GENE-040704-16
- Description:
- hypothetical protein LOC431725 [Source:RefSeq peptide;Acc:NP_001002178]
- Human Orthologue:
- RAB7A
- Human Description:
- RAB7A, member RAS oncogene family [Source:HGNC Symbol;Acc:9788]
- Mouse Orthologue:
- Rab7
- Mouse Description:
- RAB7, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105068]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2453 | Nonsense | F2 line generated | During 2018 |
sa13513 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa2453
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000004065 | Nonsense | 176 | 204 | 5 | 6 |
ENSDART00000124225 | Nonsense | 176 | 204 | 4 | 5 |
ENSDART00000004065 | Nonsense | 176 | 204 | 5 | 6 |
ENSDART00000124225 | Nonsense | 176 | 204 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 8 (position 53239898)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 50982423 GRCz11 8 50971445 - KASP Assay ID:
- 554-3183.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCATTAATGTGGAACAGGCCTTCCAGACCATCGCTCGCAATGCGCTTAAA[C/T]AGGTAGAAGAACATYCTAGAACTGTTATTGTTGTTGTTGACGAAAGAGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13513
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000004065 | Nonsense | 176 | 204 | 5 | 6 |
ENSDART00000124225 | Nonsense | 176 | 204 | 4 | 5 |
ENSDART00000004065 | Nonsense | 176 | 204 | 5 | 6 |
ENSDART00000124225 | Nonsense | 176 | 204 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 8 (position 53239898)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 50982423 GRCz11 8 50971445 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCATTAATGTGGAACAGGCCTTCCAGACCATCGCTCGCAATGCGCTTAAA[C/T]AGGTAGAAGAACATYCTAGAACTGTTATTGTTGTTGTTGACGAAAGAGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: