
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-223a10.2
- Ensembl ID:
- ENSDARG00000021255
- ZFIN ID:
- ZDB-GENE-090313-87
- Human Orthologue:
- ARHGAP22
- Human Description:
- Rho GTPase activating protein 22 [Source:HGNC Symbol;Acc:30320]
- Mouse Orthologue:
- Arhgap22
- Mouse Description:
- Rho GTPase activating protein 22 Gene [Source:MGI Symbol;Acc:MGI:2443418]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42227 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa42228 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa22334 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa42227
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014922 | Nonsense | 57 | 698 | 2 | 10 |
ENSDART00000142245 | Nonsense | 42 | 317 | 1 | 7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 31332061)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 30978009 GRCz11 13 31108459 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTAGTGAAGGCCGGCTGGCTGAAGAAACAGCGCAGCATCATGAAGAACTG[G/A]CAACTGCGCTGGTTTGTGCTCCGAACTGACCACCTCTACTTCTACAAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42228
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014922 | Essential Splice Site | 153 | 698 | 4 | 10 |
ENSDART00000142245 | Essential Splice Site | 138 | 317 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 31352253)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 30998201 GRCz11 13 31128651 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGATTGGGTCAAAGCCATCAGACGTGTCATCTGGGCTCCCTTTGGAGGAG[G/A]TAACTCATATTTATGGACCACACAAGCACAGAGACACAGGCAAAAATGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22334
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014922 | Nonsense | 697 | 698 | 10 | 10 |
ENSDART00000142245 | None | 317 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 31363360)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 31009308 GRCz11 13 31139758 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGAGTTCTTCTCCACTCTGGGGGATCTTACACTGGGAACAAGAACAAGC[A/T]AAATTTGACCGGCAGCCATGCTTATTTAACTCGGAGAGACTTCTGTGTTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Conduct disorder (symptom count): Genome-wide association study of conduct disorder symptomatology. (View Study)
- Diabetic retinopathy : Genome-wide association study of diabetic retinopathy in a Taiwanese population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: