mvp

Ensembl ID:
ENSDARG00000021242
ZFIN ID:
ZDB-GENE-030826-33
Description:
Major vault protein [Source:UniProtKB/Swiss-Prot;Acc:Q6P3L0]
Human Orthologue:
MVP
Human Description:
major vault protein [Source:HGNC Symbol;Acc:7531]
Mouse Orthologue:
Mvp
Mouse Description:
major vault protein Gene [Source:MGI Symbol;Acc:MGI:1925638]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44558 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114052 Essential Splice Site 111 863 3 17
ENSDART00000137325 Essential Splice Site 117 869 3 17
ENSDART00000141142 Essential Splice Site 117 870 3 17
Genomic Location (Zv9):
Chromosome 3 (position 15332947)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15578553
GRCz11 3 15728353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGGCCCAGGACCCGTTCCCTCTCTACCCTGGAGAAGAGATTCAGAAG[G/A]TATGATGTTAGTGTGTCTGTTTGAGAAACATGTTTGCAGCGCAGCTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link