
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_001013585.2
- Ensembl ID:
- ENSDARG00000021209
- Description:
- potassium channel tetramerisation domain containing 9 [Source:RefSeq peptide;Acc:NP_001013585]
- Human Orthologue:
- KCTD9
- Human Description:
- potassium channel tetramerisation domain containing 9 [Source:HGNC Symbol;Acc:22401]
- Mouse Orthologue:
- Kctd9
- Mouse Description:
- potassium channel tetramerisation domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:2145579]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa730 | Essential Splice Site | Available for shipment | Available now |
sa9615 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa730
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043389 | 165 | 178 | 6 | 7 | |
ENSDART00000098261 | Essential Splice Site | 164 | 178 | 6 | 8 |
ENSDART00000098263 | 167 | 391 | 6 | 12 | |
ENSDART00000145397 | 165 | 389 | 6 | 12 | |
ENSDART00000043389 | 165 | 178 | 6 | 7 | |
ENSDART00000098261 | Essential Splice Site | 164 | 178 | None | 8 |
ENSDART00000098263 | 167 | 391 | 6 | 12 | |
ENSDART00000145397 | 165 | 389 | 6 | 12 |
- Genomic Location (Zv9):
- Chromosome 8 (position 53872134)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 51607493 GRCz11 8 51594022 - KASP Assay ID:
- 554-0637.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCTCAATTACCTGAGACATGGTCAGATCATCATCAATGATGGAATAAAC[T/C]TACTCGGTGAGTCAGCCKGAATGCTACMTGAAGCGTTTTTAGGTGAYTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9615
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043389 | 165 | 178 | 6 | 7 | |
ENSDART00000098261 | Essential Splice Site | 164 | 178 | 6 | 8 |
ENSDART00000098263 | 167 | 391 | 6 | 12 | |
ENSDART00000145397 | 165 | 389 | 6 | 12 | |
ENSDART00000043389 | 165 | 178 | 6 | 7 | |
ENSDART00000098261 | Essential Splice Site | 164 | 178 | None | 8 |
ENSDART00000098263 | 167 | 391 | 6 | 12 | |
ENSDART00000145397 | 165 | 389 | 6 | 12 |
- Genomic Location (Zv9):
- Chromosome 8 (position 53872134)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 51607493 GRCz11 8 51594022 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TMCTCAATTACCTGAGACATGGTCAGATCATCATCAATGATGGAATAAAC[T/C]TACTCGGTGAGTCAGCCKGAATGCTACMTGAAGCGTTTTTAGGTGAYTGY
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: