st8sia6

Ensembl ID:
ENSDARG00000021195
ZFIN ID:
ZDB-GENE-060322-9
Description:
Alpha-2,8-sialyltransferase ST8Sia VI [Source:UniProtKB/TrEMBL;Acc:Q6KBZ7]
Human Orthologue:
ST8SIA6
Human Description:
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6 [Source:HGNC Symbol;Acc:23317]
Mouse Orthologue:
St8sia6
Mouse Description:
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6 Gene [Source:MGI Symbol;Acc:MGI:2386797

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33121 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18485 Nonsense Available for shipment Available now
sa40026 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122519 Essential Splice Site 32 359 1 7
Genomic Location (Zv9):
Chromosome 3 (position 15886080)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16116299
GRCz11 3 16266099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTGTGCTCTTTCTGCAGTGTGGCCTTCTGGATTTTCATCTCCAACAA[G/A]TGAGTATTTCAGTTTTAGCGTTTGTGTGTACCCTTTTATTTGGAGAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122519 Nonsense 117 359 4 7
Genomic Location (Zv9):
Chromosome 3 (position 15896250)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16126469
GRCz11 3 16276269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATAACACTCCTCTGGGGTCAAATGTTGTCTATGATGGCGAAMGAAGA[A/T]AGCCACTACAGGTGACCCAAGCCCTKTACAACATCTTGGCTARGGTAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122519 Nonsense 163 359 5 7
Genomic Location (Zv9):
Chromosome 3 (position 15896474)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16126693
GRCz11 3 16276493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGAATGGAGGCGTTTTGGCCAATAGCAGTTGTGGAGAAGAAATCAATT[C/A]AGCCCAGTTTGTCATTAGGTATGTCTCATATCACCCCATGTGAACTATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link