zgc:92040

Ensembl ID:
ENSDARG00000021154
ZFIN ID:
ZDB-GENE-040718-87
Description:
probable proline dehydrogenase 2 [Source:RefSeq peptide;Acc:NP_001002391]
Human Orthologue:
PRODH2
Human Description:
proline dehydrogenase (oxidase) 2 [Source:HGNC Symbol;Acc:17325]
Mouse Orthologue:
Prodh2
Mouse Description:
proline dehydrogenase (oxidase) 2 Gene [Source:MGI Symbol;Acc:MGI:1929093]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45446 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038556 Essential Splice Site 219 465 7 11
ENSDART00000128619 Essential Splice Site 239 485 6 10
ENSDART00000134292 Essential Splice Site 239 485 7 11
Genomic Location (Zv9):
Chromosome 12 (position 4614391)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3897113
GRCz11 12 3933878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTAGCAAAATGTTGTTCAGAATGAATGTTAACGTTGTGAATGTTTTC[A/G]GGCGAGTGTTAATAAAGTGCGTGTTCTGGTGGATGCAGAGTACACATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link