gpr98

Ensembl ID:
ENSDARG00000021137
ZFIN ID:
ZDB-GENE-040624-6
Description:
G-protein coupled receptor 98 [Source:UniProtKB/Swiss-Prot;Acc:Q6JAN0]
Human Orthologue:
GPR98
Human Description:
G protein-coupled receptor 98 [Source:HGNC Symbol;Acc:17416]
Mouse Orthologue:
Gpr98
Mouse Description:
G protein-coupled receptor 98 Gene [Source:MGI Symbol;Acc:MGI:1274784]

Alleles

There are 16 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31473 Essential Splice Site Available for shipment Available now
sa31474 Nonsense Available for shipment Available now
sa941 Nonsense F2 line generated During 2018
sa26566 Nonsense Mutation detected in F1 DNA During 2018
sa14823 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18129 Essential Splice Site Available for shipment Available now
sa14200 Nonsense Available for shipment Available now
sa1078 Nonsense F2 line generated During 2018
sa10539 Nonsense Available for shipment Available now
sa20524 Nonsense Available for shipment Available now
sa6062 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15969 Nonsense Available for shipment Available now
sa33703 Nonsense Mutation detected in F1 DNA During 2018
sa20525 Nonsense Available for shipment Available now
sa40550 Nonsense Mutation detected in F1 DNA During 2018
sa20526 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Essential Splice Site 405 6198 8 90
Genomic Location (Zv9):
Chromosome 5 (position 50518429)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48084127
GRCz11 5 48735638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAGTAAACGTTTTATCTGCGGTATCTCTAATCTCTGCTTATTTGTCTC[A/T]GATATGAAGGCATGATCATTGTAAGGAATGGAGGAACACACGGAGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 535 6198 9 90
Genomic Location (Zv9):
Chromosome 5 (position 50523668)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48089366
GRCz11 5 48740877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTATTCAGAGTCAGCCAGAGGGGCGATTCCTCTCCCTAAGCTTTCTC[A/T]GAGAAGGGGGGACTTTGGGAGAGGTACGACTTACACTGACTGCCCTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa941
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 544 6198 9 90
Genomic Location (Zv9):
Chromosome 5 (position 50523695)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48089393
GRCz11 5 48740904
KASP Assay ID:
554-0846.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCCTCTCCCTRAGCTTTCTCAGAGAAGGGGGGACTTTGGGAGAGGTA[C/T]GACTTACACTGACTGCCCTCTACATACCTGCCCGTCCACTGGACCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 1490 6198 21 90
Genomic Location (Zv9):
Chromosome 5 (position 50547550)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48113248
GRCz11 5 48764759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGTACTCCAGCTGCCTCAACCGCTCTCAGATTCATGAGCTTCACAAC[C/T]AACCAGCCAAAACTGACCTCCACAACGTGTCAGGATACCTGACGTACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14823
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Essential Splice Site 1632 6198 22 90
Genomic Location (Zv9):
Chromosome 5 (position 50552765)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48118463
GRCz11 5 48769974
KASP Assay ID:
1641-0487.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCAATGCTACAGGCTTYATCCTCTTCCAGYCGGGTCAGCTATCTGAG[G/A]TAACAGGATCAACTTGTCAAGCAGTTATTATTCATGACCACWAGACCACY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Essential Splice Site 1632 6198 22 90
Genomic Location (Zv9):
Chromosome 5 (position 50552766)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48118464
GRCz11 5 48769975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCAATGCKACAGGCTTYATCCTCTTCCAGYCGGGTCAGCTATCTGAGR[T/C]AACAGGATCAACTTGTCAAGCAGTTATTATTCATGACCACWAGACCACYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 1653 6198 23 90
ENSDART00000008043 Nonsense 1653 6198 23 90
Genomic Location (Zv9):
Chromosome 5 (position 50556031)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48121729
GRCz11 5 48773240
KASP Assay ID:
2259-6455.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTRGTTGTAAATGATGATCTTCCTGAAGTTKATGAGCACTTCCGGGTT[C/T]GAMTGGTGTCTGCAAAATCAGGCGATGGCAAACCAGGTTCCACTCCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1078
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 1823 6198 26 90
Genomic Location (Zv9):
Chromosome 5 (position 50558128)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48123826
GRCz11 5 48775337
KASP Assay ID:
554-0980.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYGGAAGTGGCGAGAGTGAAACTGACTTCTTTCTTCCGTCTTTTCACTA[T/A]CATCATGGTAAGATTCTTAAACTTGCTTGCCCTTTTTTCCTCTCACAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 1988 6198 28 90
Genomic Location (Zv9):
Chromosome 5 (position 50562221)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48127919
GRCz11 5 48779430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCCRTGTGGCMGAAGCAAATGCTCTTGTTGCCCTAACCATACAGAGR[A/T]GAAAGGGCTTAATGGGAAGGGTACGAGTGGCMTATCGGACACTAAGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 2578 6198 33 90
Genomic Location (Zv9):
Chromosome 5 (position 50568640)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48134338
GRCz11 5 48785849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTTTGCTCTACAGTATTAACCCTAATGCCACTCAGGAGGGTCTGTA[T/A]CTGGAAGTGAGGGAAGAACCTAAAACTACAGTGCTGCTGGTGATTGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Essential Splice Site 4202 6198 62 90
Genomic Location (Zv9):
Chromosome 5 (position 50600139)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48165837
GRCz11 5 48817348
KASP Assay ID:
554-3746.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGTTGTCATGAAAGATCGCCAGTCRGCTGCTACAATTCAACTGAAGG[T/A]AAAACTGAGCACTMCACMCAATTATTAAAARGTCTGAGGTCAGTAATCNCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 4479 6198 67 90
Genomic Location (Zv9):
Chromosome 5 (position 50607957)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48173655
GRCz11 5 48825166
KASP Assay ID:
2259-6462.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGATTTTTGAGTTGCAACTCACYGGTGCCACAGGAGGTGCCATACTT[G/T]GAGCTCAGCTAATTGCACGAATAACGATTGCCAAGAGTGACTCGCCAAAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 4493 6198 67 90
Genomic Location (Zv9):
Chromosome 5 (position 50608000)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48173698
GRCz11 5 48825209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATACTTGGAGCTCAGCTAATTGCACGAATAACGATTGCCAAGAGTGACT[C/A]GCCAAACGGTGTGGTTCGATTCATCAACCAAAGCGCCATCACCATCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 4763 6198 70 90
Genomic Location (Zv9):
Chromosome 5 (position 50610703)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48176401
GRCz11 5 48827912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTCCCAAAACCAGTCAGTGGTTGTCAACGCTGCAGACCGAAGCAGA[C/T]AACTCATTATCAGCGTCAACAGGCTGGCAGGAGCTTTCGGCAATGCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 5095 6198 74 90
Genomic Location (Zv9):
Chromosome 5 (position 50615933)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48181631
GRCz11 5 48833142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTTCTCAGCACCACCTTGCCTCTAATCACAGCTCAGCCTGAGATTGTA[C/T]AGAAAAATAGCATATCTACTGTTACCATTCGTGCTAATGATGTGGTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008043 Nonsense 6093 6198 88 90
Genomic Location (Zv9):
Chromosome 5 (position 50712066)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48277764
GRCz11 5 48929275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCACCGGTGCAGCTACTGTCGGCGGAGGAGAAATCAGCAAGTCTACG[C/T]AAAACCTCATCAGTGCCATGGAAGAGGTGTGTTCATTACCAAGGATCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link