spata6

Ensembl ID:
ENSDARG00000021115
ZFIN ID:
ZDB-GENE-050417-351
Description:
spermatogenesis-associated protein 6 [Source:RefSeq peptide;Acc:NP_001017814]
Human Orthologue:
SPATA6
Human Description:
spermatogenesis associated 6 [Source:HGNC Symbol;Acc:18309]
Mouse Orthologue:
Spata6
Mouse Description:
spermatogenesis associated 6 Gene [Source:MGI Symbol;Acc:MGI:1915196]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41157 Nonsense Mutation detected in F1 DNA During 2018
sa14361 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023751   None 419 2 13
ENSDART00000126711 Nonsense 25 467 2 19
ENSDART00000134794 Nonsense 24 455 2 13
ENSDART00000137923   None 53 None 8
ENSDART00000140867   None 111 None 3
Genomic Location (Zv9):
Chromosome 8 (position 15820616)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15265960
GRCz11 8 15303665
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCATGTCGGTATGTTGTCCCTATAGATCACTTGTCCGGGGGTGATGT[T/A]ACCGTCCCAAGAGGACATTTATTTAAGTGTGCGGATAATGGGTCAGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14361
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023751 Nonsense 234 419 8 13
ENSDART00000126711 Nonsense 327 467 12 19
ENSDART00000134794 Nonsense 270 455 8 13
ENSDART00000137923   None 53 5 8
ENSDART00000140867   None 111 None 3
Genomic Location (Zv9):
Chromosome 8 (position 15816111)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15261455
GRCz11 8 15299160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTCTAATGGAATCCTCCACGCATCTAACATCTCAGTCTTTTACTAAA[C/T]GAAGCCCCCTAGATATGCGATTACGGAGCTACAYCACAGAGCTTACAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link