zc3h7a

Ensembl ID:
ENSDARG00000021047
ZFIN ID:
ZDB-GENE-040426-2776
Description:
zinc finger CCCH domain-containing protein 7A [Source:RefSeq peptide;Acc:NP_998599]
Human Orthologue:
ZC3H7A
Human Description:
zinc finger CCCH-type containing 7A [Source:HGNC Symbol;Acc:30959]
Mouse Orthologue:
Zc3h7a
Mouse Description:
zinc finger CCCH type containing 7 A Gene [Source:MGI Symbol;Acc:MGI:2445044]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11821 Nonsense Available for shipment Available now
sa20108 Essential Splice Site Available for shipment Available now
sa40143 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30839 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11821
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017391 Nonsense 100 983 4 23
ENSDART00000148152 Nonsense 64 947 1 20
Genomic Location (Zv9):
Chromosome 3 (position 42833049)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43075956
GRCz11 3 43776873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTCAAGATCTGAATGAGAAGCTTCATGCGAACCGYGCCGCTTCCTACT[T/A]GAACATTGTAAGAATAAACATTCTTTGAGGATGCATTCAATTCAWMAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017391 Essential Splice Site 822 983 20 23
ENSDART00000148152 Essential Splice Site 786 947 17 20
Genomic Location (Zv9):
Chromosome 3 (position 42810619)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43098386
GRCz11 3 43799303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGCACAGAGGAAAGAGATCTATGGACCTTCATGAAAGACAACAATAG[T/A]AAGTTTAGTTCAGTTTGAGAATCAGTTTGACATTGAATGAATGCATACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017391 Essential Splice Site 921 983 22 23
ENSDART00000148152 Essential Splice Site 885 947 19 20
ENSDART00000017391 Essential Splice Site 921 983 22 23
ENSDART00000148152 Essential Splice Site 885 947 19 20
Genomic Location (Zv9):
Chromosome 3 (position 42805525)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43103480
GRCz11 3 43804397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGCTGGCAGTATCGTTTTCCAACCGGCACCTTTAGAGTCTGTGAGAG[G/T]TACGACACTGTTGCTGATTTTGAACTTCACCAGTCCTGCAGTCATGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017391 Essential Splice Site 921 983 22 23
ENSDART00000148152 Essential Splice Site 885 947 19 20
ENSDART00000017391 Essential Splice Site 921 983 22 23
ENSDART00000148152 Essential Splice Site 885 947 19 20
Genomic Location (Zv9):
Chromosome 3 (position 42805525)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43103480
GRCz11 3 43804397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGCTGGCAGTATCGTTTTCCAACCGGCACCTTTAGAGTCTGTGAGAG[G/T]TACGACACTGTTGCTGATTTTGAACTTCACCAGTCCTGCAGTCATGATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • QT interval: Common variants at ten loci influence QT interval duration in the QTGEN Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link