
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zc3h7a
- Ensembl ID:
- ENSDARG00000021047
- ZFIN ID:
- ZDB-GENE-040426-2776
- Description:
- zinc finger CCCH domain-containing protein 7A [Source:RefSeq peptide;Acc:NP_998599]
- Human Orthologue:
- ZC3H7A
- Human Description:
- zinc finger CCCH-type containing 7A [Source:HGNC Symbol;Acc:30959]
- Mouse Orthologue:
- Zc3h7a
- Mouse Description:
- zinc finger CCCH type containing 7 A Gene [Source:MGI Symbol;Acc:MGI:2445044]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11821 | Nonsense | Available for shipment | Available now |
sa20108 | Essential Splice Site | Available for shipment | Available now |
sa40143 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa30839 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa11821
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017391 | Nonsense | 100 | 983 | 4 | 23 |
ENSDART00000148152 | Nonsense | 64 | 947 | 1 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 42833049)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 43075956 GRCz11 3 43776873 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGCTCAAGATCTGAATGAGAAGCTTCATGCGAACCGYGCCGCTTCCTACT[T/A]GAACATTGTAAGAATAAACATTCTTTGAGGATGCATTCAATTCAWMAAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20108
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017391 | Essential Splice Site | 822 | 983 | 20 | 23 |
ENSDART00000148152 | Essential Splice Site | 786 | 947 | 17 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 42810619)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 43098386 GRCz11 3 43799303 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACAGCACAGAGGAAAGAGATCTATGGACCTTCATGAAAGACAACAATAG[T/A]AAGTTTAGTTCAGTTTGAGAATCAGTTTGACATTGAATGAATGCATACTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40143
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017391 | Essential Splice Site | 921 | 983 | 22 | 23 |
ENSDART00000148152 | Essential Splice Site | 885 | 947 | 19 | 20 |
ENSDART00000017391 | Essential Splice Site | 921 | 983 | 22 | 23 |
ENSDART00000148152 | Essential Splice Site | 885 | 947 | 19 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 42805525)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 43103480 GRCz11 3 43804397 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACTGCTGGCAGTATCGTTTTCCAACCGGCACCTTTAGAGTCTGTGAGAG[G/T]TACGACACTGTTGCTGATTTTGAACTTCACCAGTCCTGCAGTCATGATTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30839
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017391 | Essential Splice Site | 921 | 983 | 22 | 23 |
ENSDART00000148152 | Essential Splice Site | 885 | 947 | 19 | 20 |
ENSDART00000017391 | Essential Splice Site | 921 | 983 | 22 | 23 |
ENSDART00000148152 | Essential Splice Site | 885 | 947 | 19 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 42805525)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 43103480 GRCz11 3 43804397 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACTGCTGGCAGTATCGTTTTCCAACCGGCACCTTTAGAGTCTGTGAGAG[G/T]TACGACACTGTTGCTGATTTTGAACTTCACCAGTCCTGCAGTCATGATTC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- QT interval: Common variants at ten loci influence QT interval duration in the QTGEN Study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: