
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:110266
- Ensembl ID:
- ENSDARG00000021046
- ZFIN ID:
- ZDB-GENE-050417-85
- Description:
- rhomboid domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001017614]
- Human Orthologue:
- RHBDD1
- Human Description:
- rhomboid domain containing 1 [Source:HGNC Symbol;Acc:23081]
- Mouse Orthologue:
- Rhbdd1
- Mouse Description:
- rhomboid domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1924117]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35964 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa35964
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019976 | Essential Splice Site | 303 | 335 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 15 (position 35212165)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 36086356 GRCz11 15 35944325 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTGTAGTTTCAACAGTTGAGAGGTGTAAGATTGAGTTTTTATGTGTTTT[A/G]GGTGGTCATACACAAGCTAGATCATCACATGGCCCTTATGTCCCTTCTAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Pulmonary function: Framingham Heart Study genome-wide association: results for pulmonary function measures. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: