zgc:110266

Ensembl ID:
ENSDARG00000021046
ZFIN ID:
ZDB-GENE-050417-85
Description:
rhomboid domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001017614]
Human Orthologue:
RHBDD1
Human Description:
rhomboid domain containing 1 [Source:HGNC Symbol;Acc:23081]
Mouse Orthologue:
Rhbdd1
Mouse Description:
rhomboid domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1924117]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35964 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019976 Essential Splice Site 303 335 8 8
Genomic Location (Zv9):
Chromosome 15 (position 35212165)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36086356
GRCz11 15 35944325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTAGTTTCAACAGTTGAGAGGTGTAAGATTGAGTTTTTATGTGTTTT[A/G]GGTGGTCATACACAAGCTAGATCATCACATGGCCCTTATGTCCCTTCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link