ift57

Ensembl ID:
ENSDARG00000021022
ZFIN ID:
ZDB-GENE-040614-1
Description:
Intraflagellar transport protein 57 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6IVW0]
Human Orthologue:
IFT57
Human Description:
intraflagellar transport 57 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:17367]
Mouse Orthologue:
Ift57
Mouse Description:
intraflagellar transport 57 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1921166]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45115 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012919 Essential Splice Site 237 407 6 11
Genomic Location (Zv9):
Chromosome 2 (position 42308160)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42357624
GRCz11 2 42207042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCGAGTTCTTCCACAGCTTAAAGTCACCATCCGCACTGACAATAAG[G/A]TTGATGCTTGATGCATGAAAGGTGAATTAGAGACTCATTGGTTGAAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link