wu:fb63a08

Ensembl ID:
ENSDARG00000020994
ZFIN ID:
ZDB-GENE-030131-1216
Description:
Wu:fb63a08 protein [Source:UniProtKB/TrEMBL;Acc:A5D6R8]
Human Orthologue:
MAMDC2
Human Description:
MAM domain containing 2 [Source:HGNC Symbol;Acc:23673]
Mouse Orthologue:
Mamdc2
Mouse Description:
MAM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918988]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45119 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057577 Nonsense 249 739 5 15
Genomic Location (Zv9):
Chromosome 2 (position 47432645)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47437921
GRCz11 2 47289613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGACTATGGGACTGAGTGTCTACTTGCTGCAATATGGTAATGTGGCC[A/T]AAGAGGTGTGGAGGAAGAGAGAAGACCAAGGAAACATGTGGCATCTTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link