zgc:55395

Ensembl ID:
ENSDARG00000020986
ZFIN ID:
ZDB-GENE-040426-704
Description:
Cytoplasmic tRNA 2-thiolation protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q803X1]
Human Orthologues:
AC018755.1, CTU1
Human Descriptions:
cytosolic thiouridylase subunit 1 homolog (S. pombe) [Source:HGNC Symbol;Acc:29590]
Putative ATP-binding domain-containing protein 3-like protein [Source:UniProtKB/Swiss-Prot;Acc:A8MXG
Mouse Orthologue:
Ctu1
Mouse Description:
cytosolic thiouridylase subunit 1 homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:2385277]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34281 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017850 Nonsense 8 343 2 3
Genomic Location (Zv9):
Chromosome 8 (position 3608194)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3375433
GRCz11 8 3434182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGAACTGTTTTGCAGTTTGTCATCATGCCGGTCCAGTGCAGTAACTG[T/A]GAGCAGAAACGTGCCGTGCTAAAACGGCCCAAGACTGGTCACTCTCTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link