zgc:113070

Ensembl ID:
ENSDARG00000020979
ZFIN ID:
ZDB-GENE-050220-13
Description:
Protein FAM65C [Source:UniProtKB/Swiss-Prot;Acc:Q5EB20]
Human Orthologue:
FAM65C
Human Description:
family with sequence similarity 65, member C [Source:HGNC Symbol;Acc:16168]
Mouse Orthologue:
Fam65c
Mouse Description:
family with sequence similarity 65, member C Gene [Source:MGI Symbol;Acc:MGI:1916803]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1698 Essential Splice Site F2 line generated During 2018
sa25348 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40793 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1698
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015881 Essential Splice Site None 978 2 23
ENSDART00000146281 Essential Splice Site 16 997 2 23
Genomic Location (Zv9):
Chromosome 6 (position 51669239)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51718421
GRCz11 6 51718420
KASP Assay ID:
554-1644.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGAGAACAGTATGCTAACAGTTTTTCTTGTGTCTGTGTTTGTTGTA[G/A]CTGGAGGCGAGATGTCAGTGAAGCTAAAGTTTGATTACCCAGCTGAYGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015881 Essential Splice Site 672 978 16 23
ENSDART00000146281 Essential Splice Site 691 997 16 23
Genomic Location (Zv9):
Chromosome 6 (position 51699440)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51748622
GRCz11 6 51748621
KASP Assay ID:
554-7430.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCAGGCTCTTGAAACTCACCTCAGTGTCTGCGCTGTTCTGCTGAGGG[T/C]AAGCAACCTTTCCAGACAAACCACTGTTCATTATCACACAGTAACACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015881 Nonsense 777 978 19 23
ENSDART00000146281 Nonsense 796 997 19 23
Genomic Location (Zv9):
Chromosome 6 (position 51705883)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 51755065
GRCz11 6 51755064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTATGGTTTCTTGTCCTGCAGTTTTCAGTCAGCTGCTGCATCAGGTG[C/T]AGTGCAGTGGGATGGTGGCGTCTGTTACTCTGTGCACTGCAGAGCGTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link