
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:113070
- Ensembl ID:
- ENSDARG00000020979
- ZFIN ID:
- ZDB-GENE-050220-13
- Description:
- Protein FAM65C [Source:UniProtKB/Swiss-Prot;Acc:Q5EB20]
- Human Orthologue:
- FAM65C
- Human Description:
- family with sequence similarity 65, member C [Source:HGNC Symbol;Acc:16168]
- Mouse Orthologue:
- Fam65c
- Mouse Description:
- family with sequence similarity 65, member C Gene [Source:MGI Symbol;Acc:MGI:1916803]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1698 | Essential Splice Site | F2 line generated | During 2018 |
sa25348 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa40793 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa1698
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000015881 | Essential Splice Site | None | 978 | 2 | 23 |
ENSDART00000146281 | Essential Splice Site | 16 | 997 | 2 | 23 |
- Genomic Location (Zv9):
- Chromosome 6 (position 51669239)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 51718421 GRCz11 6 51718420 - KASP Assay ID:
- 554-1644.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTGTGAGAACAGTATGCTAACAGTTTTTCTTGTGTCTGTGTTTGTTGTA[G/A]CTGGAGGCGAGATGTCAGTGAAGCTAAAGTTTGATTACCCAGCTGAYGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25348
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000015881 | Essential Splice Site | 672 | 978 | 16 | 23 |
ENSDART00000146281 | Essential Splice Site | 691 | 997 | 16 | 23 |
- Genomic Location (Zv9):
- Chromosome 6 (position 51699440)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 51748622 GRCz11 6 51748621 - KASP Assay ID:
- 554-7430.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGATCAGGCTCTTGAAACTCACCTCAGTGTCTGCGCTGTTCTGCTGAGGG[T/C]AAGCAACCTTTCCAGACAAACCACTGTTCATTATCACACAGTAACACATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40793
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000015881 | Nonsense | 777 | 978 | 19 | 23 |
ENSDART00000146281 | Nonsense | 796 | 997 | 19 | 23 |
- Genomic Location (Zv9):
- Chromosome 6 (position 51705883)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 51755065 GRCz11 6 51755064 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTGTATGGTTTCTTGTCCTGCAGTTTTCAGTCAGCTGCTGCATCAGGTG[C/T]AGTGCAGTGGGATGGTGGCGTCTGTTACTCTGTGCACTGCAGAGCGTCTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: