zgc:101565

Ensembl ID:
ENSDARG00000020978
ZFIN ID:
ZDB-GENE-040912-69
Description:
hypothetical protein LOC447903 [Source:RefSeq peptide;Acc:NP_001004641]
Human Orthologue:
DHRS13
Human Description:
dehydrogenase/reductase (SDR family) member 13 [Source:HGNC Symbol;Acc:28326]
Mouse Orthologue:
Dhrs13
Mouse Description:
dehydrogenase/reductase (SDR family) member 13 Gene [Source:MGI Symbol;Acc:MGI:1917701]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1782 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011471 Nonsense 297 318 5 5
Genomic Location (Zv9):
Chromosome 10 (position 38118179)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36841117
GRCz11 10 36784875
KASP Assay ID:
554-1775.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTCAGTGGCCGTTATTTCTCATGCTGCGCTGTGGAGGAAGTCGGCGCC[A/T]AAGCCAAAGATGATGCTGTGGCCAGAAAGCTTTGGCAGATCAGCGAGCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link