zgc:112270

Ensembl ID:
ENSDARG00000020976
ZFIN IDs:
ZDB-GENE-050522-446, ZDB-GENE-050522-446
Description:
hypothetical protein LOC553697 [Source:RefSeq peptide;Acc:NP_001018507]
Human Orthologue:
FAM100A
Human Description:
family with sequence similarity 100, member A [Source:HGNC Symbol;Acc:29576]
Mouse Orthologue:
Fam100a
Mouse Description:
family with sequence similarity 100, member A Gene [Source:MGI Symbol;Acc:MGI:1916255]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38412 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005518 Nonsense 29 126 1 5
ENSDART00000074010 Nonsense 29 152 1 3
Genomic Location (Zv9):
Chromosome 3 (position 55697874)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54591600
GRCz11 3 54846202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTGTTCTTACAGCAGGATGCGCGGCGGATCAAGCAAAGCAGTTTTTA[C/T]AAGCTTCACACTGGCAGTTTGAGGTAACTTATGTTTGTTTGGTAGGACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link