
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ezrl
- Ensembl ID:
- ENSDARG00000020944
- ZFIN ID:
- ZDB-GENE-050522-18
- Description:
- ezrin like [Source:RefSeq peptide;Acc:NP_001018326]
- Human Orthologue:
- EZR
- Human Description:
- ezrin [Source:HGNC Symbol;Acc:12691]
- Mouse Orthologue:
- Ezr
- Mouse Description:
- ezrin Gene [Source:MGI Symbol;Acc:MGI:98931]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36516 | Nonsense | Available for shipment | Available now |
sa28923 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa36516
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124911 | Nonsense | 117 | 595 | 4 | 13 |
- Genomic Location (Zv9):
- Chromosome 17 (position 45601303)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 45450535 GRCz11 17 45433787 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTTTCTTCCTGCAAGTGAAGGAAAGCATCTTGAGCGATGAGATCTACTG[T/A]CCGCCAGAGACAGCGGTGCTGCTGGCCTCGTATGCTGTCCAGTCCAAGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28923
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124911 | Essential Splice Site | 541 | 595 | 12 | 13 |
- Genomic Location (Zv9):
- Chromosome 17 (position 45611830)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 45461062 GRCz11 17 45444314 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCGGATCACAGAGGCTGAGAAGAACGAGCGCGTGCAGAAACAGCTCATGG[T/C]AACACATGCTATGTGTCTACTCACAAATCTCTGCCAGTAGTTATTCTAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: