
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gli2b
- Ensembl ID:
- ENSDARG00000020884
- ZFIN ID:
- ZDB-GENE-050523-1
- Description:
- GLI-Kruppel family member GLI2b [Source:RefSeq peptide;Acc:NP_001015069]
- Human Orthologue:
- GLI2
- Human Description:
- GLI family zinc finger 2 [Source:HGNC Symbol;Acc:4318]
- Mouse Orthologue:
- Gli2
- Mouse Description:
- GLI-Kruppel family member GLI2 Gene [Source:MGI Symbol;Acc:MGI:95728]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6221 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa38862 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa38861 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa18473 | Nonsense | Available for shipment | Available now |
sa27835 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa7354 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6221
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017912 | Essential Splice Site | 229 | 1225 | 5 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 45030778)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 43609022 GRCz11 11 43684396 - KASP Assay ID:
- 554-4025.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGTGCACGATTACGTGTGTGTTCAGTARAGTGTGTATGYCGTTCCCTGC[A/T]GGAGCACCTGAGCAGTGCACAGGACCTGAAGGAGGACATGGACGACTGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38862
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017912 | Essential Splice Site | 273 | 1225 | 5 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 45030641)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 43608885 GRCz11 11 43684533 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGGGAGGGCTGCAGCAAAGAGTACGACACGCAGGAGCAGCTGGTGCAT[G/A]TAAGTGTGTGTGTGTGCGTGAGAGTGTGTGTTTGTGTGATTGTGTTAAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38861
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017912 | Essential Splice Site | 274 | 1225 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 45023393)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 43601637 GRCz11 11 43691781 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGTGTATGTCTCCTGCATTGACGTGTTGCATGTGTGTGTGTGTGTTTGC[A/G]GCACATCAACAATGAGCACATCCACGGGGAGAAGAAGGAGTTTGTGTGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18473
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017912 | Nonsense | 392 | 1225 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 45018846)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 43597090 GRCz11 11 43696328 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTTCGCAGAAACCCTAYGTGTGTAAGATCCCGGGCTGTACCAAGCGCTA[T/A]ACTGATCCCAGTTCGCTTCGGAAACACGTTAAAACCGTGCACGGGCCCGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27835
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017912 | Essential Splice Site | 577 | 1225 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 45003684)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 43581928 GRCz11 11 43711490 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCTTGATTAACCCGCCTAGTCCTAACAGATGTCATTTCTACTTTATGGC[A/T]GGTTCTTTATTGGACGGTCTGTGTGATCCAGGGCTTTCCATCTCCAGCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7354
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017912 | Missense | 633 | 1225 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 45003514)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 43581758 GRCz11 11 43711660 - KASP Assay ID:
- 554-4170.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- RGCCAGCACTGTGAGCTCTGCGTACACCTTCAGCCGGCGCTCATCYGGAA[T/G]ATCACCATGTTATTCGAGCCGTCGGTCCAGCCAAACATCMCAACCTGGCG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Age-related macular degeneration: Insights into the genetic architecture of early stage age-related macular degeneration: a genome-wide association study meta-analysis. (View Study)
- Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)
- Erectile dysfunction and prostate cancer treatment: Genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with the development of erectile dysfunction in African-American men after radiotherapy for prostate cancer. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: