zgc:194131

Ensembl ID:
ENSDARG00000020866
ZFIN ID:
ZDB-GENE-030131-3143
Description:
apolipoprotein A-IV-like [Source:RefSeq peptide;Acc:NP_001122230]
Human Orthologues:
APOA1, APOA4, APOA5
Human Descriptions:
apolipoprotein A-I [Source:HGNC Symbol;Acc:600]
apolipoprotein A-IV [Source:HGNC Symbol;Acc:602]
apolipoprotein A-V [Source:HGNC Symbol;Acc:17288]
Mouse Orthologues:
Apoa1, Apoa4, Apoa5
Mouse Descriptions:
apolipoprotein A-I Gene [Source:MGI Symbol;Acc:MGI:88049]
apolipoprotein A-IV Gene [Source:MGI Symbol;Acc:MGI:88051]
apolipoprotein A-V Gene [Source:MGI Symbol;Acc:MGI:1913363]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22836 Essential Splice Site Available for shipment Available now
sa22837 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103190   None 255 None 4
ENSDART00000132961   None 248 None 4
ENSDART00000142168   None 255 None 4
ENSDART00000147690 Essential Splice Site None 170 2 4

The following transcripts of ENSDARG00000020866 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 26186601)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24032276
GRCz11 16 23947308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTAATCAGAAAATCAGATAAATTGACGTTTATTTAAAATGAATAAAA[G/T]TCTTTTATTTACAGACTAGCGGCTTCAGTCAACATCATGAAGGTTCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22837
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103190 Essential Splice Site 64 255 None 4
ENSDART00000132961 Essential Splice Site 64 248 None 4
ENSDART00000142168 Essential Splice Site 64 255 None 4
ENSDART00000147690 Essential Splice Site 64 170 None 4

The following transcripts of ENSDARG00000020866 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 26186935)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24032610
GRCz11 16 23947642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAACCGTCAAGATGATCAGAGAGTCTCAACTGGGTCAAGAAGTCAAG[T/C]AAGTCAAGAACATTTACCTGCTGGACATCATTATTTAGAGTATTTCTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link