
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:194131
- Ensembl ID:
- ENSDARG00000020866
- ZFIN ID:
- ZDB-GENE-030131-3143
- Description:
- apolipoprotein A-IV-like [Source:RefSeq peptide;Acc:NP_001122230]
- Human Orthologues:
- APOA1, APOA4, APOA5
- Human Descriptions:
- apolipoprotein A-I [Source:HGNC Symbol;Acc:600]
- apolipoprotein A-IV [Source:HGNC Symbol;Acc:602]
- apolipoprotein A-V [Source:HGNC Symbol;Acc:17288]
- Mouse Orthologues:
- Apoa1, Apoa4, Apoa5
- Mouse Descriptions:
- apolipoprotein A-I Gene [Source:MGI Symbol;Acc:MGI:88049]
- apolipoprotein A-IV Gene [Source:MGI Symbol;Acc:MGI:88051]
- apolipoprotein A-V Gene [Source:MGI Symbol;Acc:MGI:1913363]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22836 | Essential Splice Site | Available for shipment | Available now |
sa22837 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22836
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103190 | None | 255 | None | 4 | |
ENSDART00000132961 | None | 248 | None | 4 | |
ENSDART00000142168 | None | 255 | None | 4 | |
ENSDART00000147690 | Essential Splice Site | None | 170 | 2 | 4 |
The following transcripts of ENSDARG00000020866 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 26186601)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 24032276 GRCz11 16 23947308 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTATTAATCAGAAAATCAGATAAATTGACGTTTATTTAAAATGAATAAAA[G/T]TCTTTTATTTACAGACTAGCGGCTTCAGTCAACATCATGAAGGTTCTTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22837
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103190 | Essential Splice Site | 64 | 255 | None | 4 |
ENSDART00000132961 | Essential Splice Site | 64 | 248 | None | 4 |
ENSDART00000142168 | Essential Splice Site | 64 | 255 | None | 4 |
ENSDART00000147690 | Essential Splice Site | 64 | 170 | None | 4 |
The following transcripts of ENSDARG00000020866 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 26186935)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 24032610 GRCz11 16 23947642 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGAAACCGTCAAGATGATCAGAGAGTCTCAACTGGGTCAAGAAGTCAAG[T/C]AAGTCAAGAACATTTACCTGCTGGACATCATTATTTAGAGTATTTCTGAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cardiovascular disease risk factors: Longitudinal genome-wide association of cardiovascular disease risk factors in the Bogalusa heart study. (View Study)
- Carotenoid and tocopherol levels: Common variation in the beta-carotene 15,15'-monooxygenase 1 gene affects circulating levels of carotenoids: a genome-wide association study. (View Study)
- Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)
- Coronary heart disease: Large-scale association analysis identifies 13 new susceptibility loci for coronary artery disease. (View Study)
- Hypertriglyceridemia: Excess of rare variants in genes identified by genome-wide association study of hypertriglyceridemia. (View Study)
- Metabolite levels: Genome-wide association study identifies multiple loci influencing human serum metabolite levels. (View Study)
- Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Response to Vitamin E supplementation: Genome-wide association study identifies three common variants associated with serologic response to vitamin E supplementation in men. (View Study)
- Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)
- Triglycerides: A genome-wide association and gene-environment interaction study for serum triglycerides levels in a healthy Chinese male population. (View Study)
- Triglycerides: A null mutation in human APOC3 confers a favorable plasma lipid profile and apparent cardioprotection. (View Study)
- Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
- Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
- Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
- Triglycerides: Genome-wide scan identifies variation in MLXIPL associated with plasma triglycerides. (View Study)
- Triglycerides: Large-scale genome-wide association studies in East Asians identify new genetic loci influencing metabolic traits. (View Study)
- Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)
- Triglycerides: Newly identified loci that influence lipid concentrations and risk of coronary artery disease. (View Study)
- Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)
- Urate levels: Genome-wide association study identifies genes for biomarkers of cardiovascular disease: serum urate and dyslipidemia. (View Study)
- Vitamin E levels: Genome-wide association study identifies common variants associated with circulating vitamin E levels. (View Study)
- Waist Circumference - Triglycerides (WC-TG): A bivariate genome-wide approach to metabolic syndrome: STAMPEED consortium. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: