ef1a

Ensembl ID:
ENSDARG00000020850
ZFIN IDs:
ZDB-GENE-050706-188, ZDB-GENE-990415-52
Description:
Elongation factor 1-alpha [Source:UniProtKB/Swiss-Prot;Acc:Q92005]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23594 Essential Splice Site Available for shipment Available now
sa45683 Nonsense Mutation detected in F1 DNA During 2018
sa36916 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023156 Essential Splice Site 48 462 None 8
ENSDART00000039129 Essential Splice Site 48 462 None 8
ENSDART00000129362 Essential Splice Site 48 462 None 8
Genomic Location (Zv9):
Chromosome 19 (position 45288206)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43524259
GRCz11 19 43119856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAATCGACAAGAGAACCATCGAGAAGTTCGAGAAGGAAGCCGCTGAGG[T/C]AAGCGTTCAACCGGTTGGATTTATTCTTAATCAATTTATGCGCTTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023156 Nonsense 164 462 4 8
ENSDART00000039129   None 462 None 8
ENSDART00000129362   None 462 None 8
Genomic Location (Zv9):
Chromosome 19 (position 45288951)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43525004
GRCz11 19 43120601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGATCGTTGGAGTCAACAAGATGGACTCCACTGAGCCCCCTTACAGC[C/T]AGGCTCGTTTTGAGGAAATCACCAAGGAAGTCAGCGCATACATCAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023156   None 462 None 8
ENSDART00000039129   None 462 None 8
ENSDART00000129362 Essential Splice Site 108 462 3 8
Genomic Location (Zv9):
Chromosome 19 (position 45294181)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43530234
GRCz11 19 43125831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCGGACACAGAGACTTCATCAAGAACATGATCACTGGTACTTCTCAGG[T/C]ATGTCTACAACTGTGATTCTAGAAATTTCAATTTTCAAGGATTTTTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link