zgc:77304

Ensembl ID:
ENSDARG00000020841
ZFIN ID:
ZDB-GENE-030131-6724
Description:
RNA-binding protein 7 [Source:RefSeq peptide;Acc:NP_956219]
Human Orthologue:
RBM7
Human Description:
RNA binding motif protein 7 [Source:HGNC Symbol;Acc:9904]
Mouse Orthologue:
Rbm7
Mouse Description:
RNA binding motif protein 7 Gene [Source:MGI Symbol;Acc:MGI:1914260]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43178 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009775 Nonsense 77 252 2 5
Genomic Location (Zv9):
Chromosome 18 (position 45751369)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 47309057
GRCz11 18 47304449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGTGCCCTATGCCTTGAACTTGCTGAATGGAATCCGTCTGCATGGA[C/T]GACAGCTCAACATAAAGTTCAAAACCGGTAGGACTTTCCTTATTGCGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link