si:dkey-230p4.1

Ensembl ID:
ENSDARG00000020834
ZFIN ID:
ZDB-GENE-081104-380
Description:
Novel protein with a Viral A-type inclusion protein repeat domain [Source:UniProtKB/TrEMBL;Acc:B0V3B
Human Orthologues:
AC104809.3, CEP250, CROCC
Human Descriptions:
centrosomal protein 250kDa [Source:HGNC Symbol;Acc:1859]
ciliary rootlet coiled-coil, rootletin [Source:HGNC Symbol;Acc:21299]
Mouse Orthologues:
Cep250, Crocc
Mouse Descriptions:
centrosomal protein 250 Gene [Source:MGI Symbol;Acc:MGI:108084]
ciliary rootlet coiled-coil, rootletin Gene [Source:MGI Symbol;Acc:MGI:3529431]

Alleles

There are 15 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34573 Nonsense Mutation detected in F1 DNA During 2018
sa41371 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41372 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41373 Nonsense Mutation detected in F1 DNA During 2018
sa2522 Nonsense F2 line generated During 2018
sa12127 Nonsense Available for shipment Available now
sa34574 Nonsense Mutation detected in F1 DNA During 2018
sa21446 Nonsense Available for shipment Available now
sa34575 Nonsense Mutation detected in F1 DNA During 2018
sa30914 Nonsense Mutation detected in F1 DNA During 2018
sa34576 Nonsense Mutation detected in F1 DNA During 2018
sa31705 Nonsense Available for shipment Available now
sa11150 Nonsense Available for shipment Available now
sa15179 Nonsense Available for shipment Available now
sa34577 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 465 2775 10 22
ENSDART00000134484   None 327 None 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13202148)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12954713
GRCz11 9 12925916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAGTGAGTGGGTGGAGCTTCAGGAACAGACCAATCAGGGCGCACTA[C/T]AGATTAAACACACACAGGAACTGTTGAACAGGTGATGAATGCTTCATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Essential Splice Site 663 2775 14 22
ENSDART00000134484 Essential Splice Site 51 327 2 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13211131)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12963696
GRCz11 9 12934899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTGCACAGGGAACTGAAGGCCATGTCTCTAGAGGTCCACGAATTAAG[G/A]TGCGCAACGGTGAAGCAGATTTTAATTTTTAATTTTCATATTTAGAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Essential Splice Site 714 2775 15 22
ENSDART00000134484 Essential Splice Site 102 327 3 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13216405)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12968970
GRCz11 9 12940173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGGCCCGCACTGAAGACAAGAGCACAGATGAACAAAAGATTTCAGAG[G/A]TGAGAAACCCAGACAATGCTGCCTGCCTGCCAGACAGATTCAGAAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 821 2775 17 22
ENSDART00000134484 Nonsense 209 327 5 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13219772)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12972337
GRCz11 9 12943540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGCTACAAATGCAGGTGGACACACTCACACAGACCAAAGATGTCTTG[C/T]AAGGTTGGTCAAGCTGTTTTAATATAAAACAAACCTCTTATTTTTGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2522
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 868 2775 18 22
ENSDART00000134484 Nonsense 256 327 6 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13220036)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12972601
GRCz11 9 12943804
KASP Assay ID:
554-3313.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTGAAAGAGAGATAGAAAACTGGAAGTCGGAATGCAAGAAGTTTCAG[A/T]GAGACGTTGAACAAGAATCAGAAAATAGCAAAATACAAGCAGAAGAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 936 2775 18 22
ENSDART00000134484 Nonsense 324 327 6 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13220240)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12972805
GRCz11 9 12944008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTAAAAGAAAAAGAAGAGCTTTTGGACMATTTAGAAAAAAGAAACACA[G/T]AACTAGAGAAACTACAGACTAAATCTGCARCAGAACAGAAAKCGGCCGAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 1162 2775 18 22
ENSDART00000134484   None 327 None 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13220918)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12973483
GRCz11 9 12944686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGCTGAGACTGAAAGAGGCAAGAGACAATGCAGAGTGGTGGAAGAGA[C/T]GAGCTGGCAACATGGAGAAAGTGAAGGAGAGCGTAAATCGTGTTGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 1236 2775 18 22
ENSDART00000134484   None 327 None 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13221140)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12973705
GRCz11 9 12944908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGACTGATATTGAGCAGAAGAATGAACAGCTTGAACTTCTAAATGAG[C/T]AAATCTCACAGATAAAAGAGAGAGAAATTGAGAATCAAAAAGAGTTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 1308 2775 18 22
ENSDART00000134484   None 327 None 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13221356)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12973921
GRCz11 9 12945124
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGAGAGATGGTGAGTTGACAGAATTACAAGTGAAATTCACTCAAGAA[C/T]AGAGGATGTTTGAACAGAAGCTTAAAGCAGAACATGCAGAGGTGAACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 1473 2775 18 22
ENSDART00000134484   None 327 None 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13221851)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12974416
GRCz11 9 12945619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAAGCAGTTTACAAGAAATCGAAACAACGCTTGAGAAGGAAAGATAT[C/T]AGCTCAGAGGAAAAGAAGAAAGACTTATGGAGTGTAATGAAGAGCTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 1699 2775 18 22
ENSDART00000134484   None 327 None 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13222529)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12975094
GRCz11 9 12946297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTAAAGGAGAAAATGAATGAAATTTTAGAAGAAGAGAGAAAGTTATCA[C/T]AACTACTGCAGAACAGCCGAGTGGAGGCTCAAATGCTTGAATCCAGGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 2075 2775 18 22
ENSDART00000134484   None 327 None 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13223658)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12976223
GRCz11 9 12947426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGATGAAACTCTTCGAGAGAGACGAGAGAAGGACAGAATAAGCTCTT[T/A]ATTGAGTGATGCCAAGGAAAGAAAGGAATCACTGTCTGTCCAGGTCGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 2217 2775 18 22
ENSDART00000134484   None 327 None 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13224084)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12976649
GRCz11 9 12947852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCAACTTAARAAGAAGAATGAGGAAGGGATGCAGGAGAAGGAACAAT[T/A]GCAGCAAAGACAGGAAAAGTTGGAAGRAGAATTGRTGGCTATGAAAAGCS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15179
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 2276 2775 18 22
ENSDART00000134484   None 327 None 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13224260)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12976825
GRCz11 9 12948028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCTCTTTGGCAGCAGAGAGGACCAAAGATGCAGAGGAACTRAGCAAC[A/T]GATTCAGAGATCTGAGGCTGGAAGCTGACAGGCTGAGAGAGGACAGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102348 Nonsense 2402 2775 18 22
ENSDART00000134484   None 327 None 6
ENSDART00000135797   None 193 None 2
ENSDART00000139377   None 233 None 7

The following transcripts of ENSDARG00000020834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 13224639)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12977204
GRCz11 9 12948407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTAGATTGCAGGATCAATTCGAAGATGAGAAAAGAGTTACCAAGAAAT[T/A]GAGGGAAAAATTAGAAACCCTAGAGAAAGTGAAACAAGAGATGAAGACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • IgE grass sensitization: A genome-wide meta-analysis of genetic variants associated with allergic rhinitis and grass sensitization and their interaction with birth order. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link