srp68

Ensembl ID:
ENSDARG00000020820
ZFIN ID:
ZDB-GENE-040831-3
Description:
signal recognition particle 68 [Source:RefSeq peptide;Acc:NP_001005401]
Human Orthologue:
SRP68
Human Description:
signal recognition particle 68kDa [Source:HGNC Symbol;Acc:11302]
Mouse Orthologue:
Srp68
Mouse Description:
signal recognition particle 68 Gene [Source:MGI Symbol;Acc:MGI:1917447]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45250 Nonsense Mutation detected in F1 DNA During 2018
sa20689 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124948 Nonsense 328 617 9 16
Genomic Location (Zv9):
Chromosome 6 (position 21623934)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17939708
GRCz11 6 23037627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATAACTGTTCACAGGCAGATAATGAAGAGACTAAGGAGCACCTGTA[T/A]GAGAGTCTGCTGGCAGAGTGTAGAGACACCATCCAGGCTGTCAGGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124948 Essential Splice Site 456 617 12 16
Genomic Location (Zv9):
Chromosome 6 (position 21630233)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 17946007
GRCz11 6 23043926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCCAGAAAGAACTGTCCCTCAAGACTTTGGTCTACAAGGCTTACAGG[T/A]GATTTTATTTCCTTGGTGGGATCTGCTATACAGATCTTTAGGAGACTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link