zgc:73124

Ensembl ID:
ENSDARG00000020798
ZFIN ID:
ZDB-GENE-040426-1682
Description:
adaptin ear-binding coat-associated protein 1 [Source:RefSeq peptide;Acc:NP_957016]
Human Orthologue:
NECAP1
Human Description:
NECAP endocytosis associated 1 [Source:HGNC Symbol;Acc:24539]
Mouse Orthologue:
Necap1
Mouse Description:
NECAP endocytosis associated 1 Gene [Source:MGI Symbol;Acc:MGI:1914852]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45663 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028048 Nonsense 77 261 3 8
Genomic Location (Zv9):
Chromosome 19 (position 11024195)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10482734
GRCz11 19 10401659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATAACTGTCTTCAGGTGAGCTATTTGCTCAAGCGCCAGTGAATGAGTA[T/A]CCAGGCATTGCTTTGGAGACGGTCAGTGATTCCAGTCGCTATTTTGTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link