
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
caprin2
- Ensembl ID:
- ENSDARG00000020749
- ZFIN ID:
- ZDB-GENE-040812-2
- Description:
- Caprin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q5RJ80]
- Human Orthologue:
- CAPRIN2
- Human Description:
- caprin family member 2 [Source:HGNC Symbol;Acc:21259]
- Mouse Orthologue:
- Caprin2
- Mouse Description:
- caprin family member 2 Gene [Source:MGI Symbol;Acc:MGI:2448541]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12716 | Nonsense | Available for shipment | Available now |
sa6049 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa12256 | Nonsense | Available for shipment | Available now |
sa14869 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12716
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040708 | Nonsense | 200 | 914 | 5 | 21 |
ENSDART00000064009 | None | 331 | None | 6 | |
ENSDART00000125323 | None | 329 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 4 (position 15694236)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 16637076 GRCz11 4 16626052 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCCTGCTACATGTCCACTCAAGACATGGAGGGTTTGATGGATTTGGCRT[C/G]ACTGGTGGGATGYAAAAGGGATTACAGCATTAGGTTTGCACTATTGGATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6049
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040708 | Nonsense | 384 | 914 | 10 | 21 |
ENSDART00000064009 | None | 331 | None | 6 | |
ENSDART00000125323 | None | 329 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 4 (position 15692089)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 16634929 GRCz11 4 16623905 - KASP Assay ID:
- 554-3814.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CATACTGTAGAGAAAATKTGTTAAACTTCTGTCTCTTTTTCTAGAAACGT[C/T]AAAGAAAGAAGGCTGAGCAAGACTCCAAATCTGTGAGTTTTTGATCAGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12256
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040708 | Nonsense | 390 | 914 | 10 | 21 |
ENSDART00000064009 | None | 331 | None | 6 | |
ENSDART00000125323 | None | 329 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 4 (position 15692071)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 16634911 GRCz11 4 16623887 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTTAAACTTCTGTCTCTTTTTCTAGAAACGTYAAAGAAAGAAGGCTGAG[C/T]AAGACTCCAAATCTGTGAGTTTTTGATCAGAGGATCCANNNNAACCTTKGTAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14869
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000040708 | Nonsense | 438 | 914 | 12 | 21 |
ENSDART00000064009 | None | 331 | None | 6 | |
ENSDART00000125323 | None | 329 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 4 (position 15691763)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 16634603 GRCz11 4 16623579 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCAGTGTTTTTTAAATSCCCAATATAATNNNNGTTTGCAGGAGTCTCTTT[T/A]GGATGGAGAATCTTCACCTGYSAACWCTCAAACAAAAAGATGCCGTCCAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: