zgc:123333

Ensembl ID:
ENSDARG00000020742
ZFIN ID:
ZDB-GENE-051113-256
Description:
alpha-N-acetylgalactosaminidase [Source:RefSeq peptide;Acc:NP_001032465]
Human Orthologue:
NAGA
Human Description:
N-acetylgalactosaminidase, alpha- [Source:HGNC Symbol;Acc:7631]
Mouse Orthologue:
Naga
Mouse Description:
N-acetyl galactosaminidase, alpha Gene [Source:MGI Symbol;Acc:MGI:1261422]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17862 Essential Splice Site Available for shipment Available now
sa25269 Nonsense Mutation detected in F1 DNA During 2018
sa14996 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125936 Essential Splice Site 146 415 4 9
Genomic Location (Zv9):
Chromosome 4 (position 759719)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 975465
GRCz11 4 988913
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MATGCTCAAGTTGGACGGATGTTACTCCAACTCGTCCTATCAGGAACAAG[G/A]TACATCGCYAATCTGTGTCAGCTCAGATCTAAAAGSAAGGTCAAGACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125936 Nonsense 226 415 6 9
Genomic Location (Zv9):
Chromosome 4 (position 759206)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 974952
GRCz11 4 988400
KASP Assay ID:
554-7614.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGTTCTTCGACAATCAGGACGCCCTTCAGCCTGCAGCCGCACCAGGA[C/T]AGTGGAACGACCCAGACATGGTGAGCTCCACACCGATGACCCTGAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14996
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125936 Essential Splice Site 298 415 7 9
Genomic Location (Zv9):
Chromosome 4 (position 758342)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 974087
GRCz11 4 987535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTYCATCAACCAGGACCCGCTGGGCATCCAGGGCAGACGCCTGCTCAAGG[T/C]GCACACGCCTAAATAATGCTCCTGCTTAATTATTTATTTCAWTATTGTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link