zgc:153921

Ensembl ID:
ENSDARG00000020738
ZFIN ID:
ZDB-GENE-060929-816
Description:
hypothetical protein LOC791500 [Source:RefSeq peptide;Acc:NP_001070235]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19920 Essential Splice Site Available for shipment Available now
sa31306 Nonsense Available for shipment Available now
sa31307 Nonsense Available for shipment Available now
sa25968 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011111 Essential Splice Site None 563 1 5
Genomic Location (Zv9):
Chromosome 3 (position 1811155)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1269367
GRCz11 3 1038016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGAAGATCTCATCTCTTAAACTATCAAGAACACACAGAGACTGCAGG[T/C]AAGAATGGGAACAGCTGCTTGTGTTTAGAGCTCAAGTAGACTATTCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011111 Nonsense 173 563 5 5
Genomic Location (Zv9):
Chromosome 3 (position 1817094)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1275306
GRCz11 3 1043955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCTCAACCCGACAGTCCAGAGTTACCATGCATTACAGTGCAACCACA[C/T]GATTCGATCAGCTCACGATGAGTCACCTGGGCACCATCACCTACCCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011111 Nonsense 227 563 5 5
Genomic Location (Zv9):
Chromosome 3 (position 1817256)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1275468
GRCz11 3 1044117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGGTGTTTGATCGCATGCTTTCAGAACAGGAGAACAGTGAACACATT[G/T]AGACTGAAATGAGCCTCATGGTGAAAAAGATGACGTCAGTAAACGTAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011111 Nonsense 303 563 5 5
Genomic Location (Zv9):
Chromosome 3 (position 1817486)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1275698
GRCz11 3 1044347
KASP Assay ID:
2259-2903.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAATTTGCTGAACCAGCAGACCGCAGTCCCAGTGAAGGTCTGGCTGTA[T/A]CCGCTGCATCTCCTGAACTCAGCAGCAGCTCGAGTGGAGAGAGAAATCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link