zgc:172056

Ensembl ID:
ENSDARG00000020527
ZFIN ID:
ZDB-GENE-030131-8491
Description:
nuclear pore glycoprotein p62 [Source:RefSeq peptide;Acc:NP_001107068]
Human Orthologues:
NUP62, NUP62CL
Human Descriptions:
nucleoporin 62kDa C-terminal like [Source:HGNC Symbol;Acc:25960]
nucleoporin 62kDa [Source:HGNC Symbol;Acc:8066]
Mouse Orthologues:
Nup62, Nup62cl
Mouse Descriptions:
nucleoporin 62 C-terminal like Gene [Source:MGI Symbol;Acc:MGI:2685565]
nucleoporin 62 Gene [Source:MGI Symbol;Acc:MGI:1351500]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28269 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041523 Nonsense 474 507 12 13
ENSDART00000131295 Nonsense 474 507 12 13
ENSDART00000136480   None 214 None 5

The following transcripts of ENSDARG00000020527 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 10854546)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10349903
GRCz11 14 10655917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGATCTGCAAAATTCTCAATGCACACATGGACTCCTTACAATGGGTG[G/T]AGCAAAATTCAGGTCAGTATCCACTTAAATTCGATACATATTTCGCTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link