zgc:110306

Ensembl ID:
ENSDARG00000020488
ZFIN ID:
ZDB-GENE-050417-56
Description:
hypothetical protein LOC550254 [Source:RefSeq peptide;Acc:NP_001017592]
Human Orthologue:
ARHGAP17
Human Description:
Rho GTPase activating protein 17 [Source:HGNC Symbol;Acc:18239]
Mouse Orthologue:
Arhgap17
Mouse Description:
Rho GTPase activating protein 17 Gene [Source:MGI Symbol;Acc:MGI:1917747]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42018 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35275 Nonsense Mutation detected in F1 DNA During 2018
sa22085 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045713   None 250 None 9
ENSDART00000115015 Essential Splice Site 322 774 10 17
Genomic Location (Zv9):
Chromosome 12 (position 21820863)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20346496
GRCz11 12 20468370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTTTGATGACTTACCAGCTGTATGATGAATGGATACAGGCCTCCAAG[T/C]AAGCCATCTAACTGTGGTTTACACTAGGCTTTAAATGAAGTTTGTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045713   None 250 None 9
ENSDART00000115015 Nonsense 562 774 16 17
Genomic Location (Zv9):
Chromosome 12 (position 21828675)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20354308
GRCz11 12 20476182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTTTGTTGATTGACTTTTCTGTCTGTTTGTTTAACAGTTCAAAGAGC[C/T]GAGACTCTGCATCCACTCCTCCTGCTCAGAGAAATGGCACTGGAGGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045713   None 250 None 9
ENSDART00000115015 Nonsense 628 774 17 17
Genomic Location (Zv9):
Chromosome 12 (position 21830868)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20356501
GRCz11 12 20478375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAGCCAACCCTCCACCAATCCAACCAGCCAATCAGCCCGTTCCACAA[C/T]AGACCCAATCAGGCACCCCTCAGTCCTTCAGCCCGTCCCCTAGACCGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link