
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:110306
- Ensembl ID:
- ENSDARG00000020488
- ZFIN ID:
- ZDB-GENE-050417-56
- Description:
- hypothetical protein LOC550254 [Source:RefSeq peptide;Acc:NP_001017592]
- Human Orthologue:
- ARHGAP17
- Human Description:
- Rho GTPase activating protein 17 [Source:HGNC Symbol;Acc:18239]
- Mouse Orthologue:
- Arhgap17
- Mouse Description:
- Rho GTPase activating protein 17 Gene [Source:MGI Symbol;Acc:MGI:1917747]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42018 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa35275 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22085 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa42018
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045713 | None | 250 | None | 9 | |
ENSDART00000115015 | Essential Splice Site | 322 | 774 | 10 | 17 |
- Genomic Location (Zv9):
- Chromosome 12 (position 21820863)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 20346496 GRCz11 12 20468370 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACCTTTGATGACTTACCAGCTGTATGATGAATGGATACAGGCCTCCAAG[T/C]AAGCCATCTAACTGTGGTTTACACTAGGCTTTAAATGAAGTTTGTGTTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35275
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045713 | None | 250 | None | 9 | |
ENSDART00000115015 | Nonsense | 562 | 774 | 16 | 17 |
- Genomic Location (Zv9):
- Chromosome 12 (position 21828675)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 20354308 GRCz11 12 20476182 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATTTTTGTTGATTGACTTTTCTGTCTGTTTGTTTAACAGTTCAAAGAGC[C/T]GAGACTCTGCATCCACTCCTCCTGCTCAGAGAAATGGCACTGGAGGCTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22085
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045713 | None | 250 | None | 9 | |
ENSDART00000115015 | Nonsense | 628 | 774 | 17 | 17 |
- Genomic Location (Zv9):
- Chromosome 12 (position 21830868)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 20356501 GRCz11 12 20478375 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACCAGCCAACCCTCCACCAATCCAACCAGCCAATCAGCCCGTTCCACAA[C/T]AGACCCAATCAGGCACCCCTCAGTCCTTCAGCCCGTCCCCTAGACCGCTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: