yipf3

Ensembl ID:
ENSDARG00000020449
ZFIN ID:
ZDB-GENE-030131-6443
Description:
Protein YIPF3 [Source:UniProtKB/Swiss-Prot;Acc:Q803Z2]
Human Orthologue:
YIPF3
Human Description:
Yip1 domain family, member 3 [Source:HGNC Symbol;Acc:21023]
Mouse Orthologue:
Yipf3
Mouse Description:
Yip1 domain family, member 3 Gene [Source:MGI Symbol;Acc:MGI:106280]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42123 Nonsense Mutation detected in F1 DNA During 2018
sa35405 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012759 Nonsense 2 344 1 9
Genomic Location (Zv9):
Chromosome 13 (position 3593294)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3808114
GRCz11 13 3938710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCTAAAGTTTCCGTTTATATTATTGTGGCTGTCAGTGCAAAACAATGT[C/A]GGCATCACAAGGAAGCAAAAACACGAACGCGGAACCATGGGGAGGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012759 Nonsense 90 344 2 9
Genomic Location (Zv9):
Chromosome 13 (position 3596712)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3811532
GRCz11 13 3942128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATGGAGAATTCCTCGGGATGAAGGGCCTGAAGGGACAGCTGGGCAGA[C/T]AGGTTGCAGATGAGGTGAGAACATTTGATCTTGCATTTTTATTTCATTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link