zgc:92416

Ensembl ID:
ENSDARG00000020427
ZFIN ID:
ZDB-GENE-040711-2
Description:
hypothetical protein LOC432374 [Source:RefSeq peptide;Acc:NP_001002303]
Human Orthologue:
NCEH1
Human Description:
neutral cholesterol ester hydrolase 1 [Source:HGNC Symbol;Acc:29260]
Mouse Orthologue:
Nceh1
Mouse Description:
arylacetamide deacetylase-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443191]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39835 Nonsense Mutation detected in F1 DNA During 2018
sa32925 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019593 Nonsense 116 407 2 5
ENSDART00000134543 Nonsense 117 408 2 5
Genomic Location (Zv9):
Chromosome 2 (position 24908669)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25483446
GRCz11 2 25139080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGAAGAAAAGCTGAGGAGAGCTGTCATGTTCATTCATGGAGGTGGAT[G/A]GTCCTTGGGTGCTCCAAGTAAGTTTTTCTATTGAATTAATTCATTCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019593 Nonsense 116 407 2 5
ENSDART00000134543 Nonsense 117 408 2 5
Genomic Location (Zv9):
Chromosome 2 (position 24908668)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25483445
GRCz11 2 25139079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAAGAAAAGCTGAGGAGAGCTGTCATGTTCATTCATGGAGGTGGATG[G/A]TCCTTGGGTGCTCCAAGTAAGTTTTTCTATTGAATTAATTCATTCAATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link