zgc:64136

Ensembl ID:
ENSDARG00000020397
ZFIN ID:
ZDB-GENE-040426-1377
Description:
sorting nexin-15 [Source:RefSeq peptide;Acc:NP_001104707]
Human Orthologue:
SNX15
Human Description:
sorting nexin 15 [Source:HGNC Symbol;Acc:14978]
Mouse Orthologue:
Snx15
Mouse Description:
sorting nexin 15 Gene [Source:MGI Symbol;Acc:MGI:1916274]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44655 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010932 Nonsense 246 398 6 8
Genomic Location (Zv9):
Chromosome 7 (position 21116782)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19707218
GRCz11 7 19959186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAAAGTTTTAAACAATGGTTTACTGCTCCATTGCAGATGCTTCGCCT[G/T]AAATGCCAGGCTCTCCAATCGACCAGTTGGAAGAGTTTGATGCACTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link