zgc:56466

Ensembl ID:
ENSDARG00000020387
ZFIN ID:
ZDB-GENE-040426-1037
Description:
protein NipSnap homolog 3A [Source:RefSeq peptide;Acc:NP_956558]
Human Orthologues:
NIPSNAP3A, NIPSNAP3B
Human Descriptions:
nipsnap homolog 3A (C. elegans) [Source:HGNC Symbol;Acc:23619]
nipsnap homolog 3B (C. elegans) [Source:HGNC Symbol;Acc:23641]
Mouse Orthologues:
Nipsnap3a, Nipsnap3b
Mouse Descriptions:
nipsnap homolog 3A (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1920648]
nipsnap homolog 3B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913786]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24952 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125058 Nonsense 34 272 1 6
Genomic Location (Zv9):
Chromosome 14 (position 6492713)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6220100
GRCz11 14 6526827
KASP Assay ID:
554-7782.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGATAAAATTACGCAGTATTGTCCGGAGCGCGTCACGGCACGCAGAA[C/T]GATGTCTGACCGTGAAAAACCGACTTACGGTGAGTTTAATCAGCACTCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link