
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
EXT1A_DANRE
- Ensembl ID:
- ENSDARG00000020373
- Description:
- Exostosin-1a [Source:UniProtKB/Swiss-Prot;Acc:Q5IGR8]
- Human Orthologue:
- EXT1
- Human Description:
- exostosin 1 [Source:HGNC Symbol;Acc:3512]
- Mouse Orthologue:
- Ext1
- Mouse Description:
- exostoses (multiple) 1 Gene [Source:MGI Symbol;Acc:MGI:894663]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22952 | Nonsense | Available for shipment | Available now |
sa36257 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa2874 | Nonsense | F2 line generated | During 2018 |
sa36258 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa9715 | Splice Site, Nonsense | Available for shipment | Available now |
sa4684 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa22952
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006439 | Nonsense | 324 | 730 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 51878640)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 48602953 GRCz11 16 48544971 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTATAAAGAAATGCTGCACAACTCCACATTCTGTCTGGTGCCGAGAGGA[C/T]GACGCCTGGGCTCTTTCCGCTTCCTGGAGGCTCTGCAGGTACACTTTTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36257
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006439 | Essential Splice Site | 336 | 730 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 51878679)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 48602992 GRCz11 16 48545010 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCCGAGAGGACGACGCCTGGGCTCTTTCCGCTTCCTGGAGGCTCTGCAG[G/A]TACACTTTTACAGTCCAATTTTGTTGCTAATTACAGGCTGTTACTGTTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2874
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006439 | Nonsense | 368 | 730 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 51889184)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 48613497 GRCz11 16 48555515 - KASP Assay ID:
- 554-3318.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCTTCTCCGAGATCATCRACTGGCGGACGGCTGCTGTCATCGGGGACGAG[A/T]GACTTCTTCTACAGGTAACACTTCCAGAAAACATCAAAACCCCAAAAACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36258
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006439 | Nonsense | 382 | 730 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 51896275)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 48620588 GRCz11 16 48562606 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACTGCTCTCTTCTCTTCGCAGATTCCATCGACAGTTCGCTCCATCCAT[C/T]AAGATCGCATTCTGTCACTCCGGCAGCAGACGCAGTTCCTCTGGGAAGCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9715
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006439 | Splice Site, Nonsense | 528 | 730 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 51901087)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 48625400 GRCz11 16 48567418 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCGCTGGCCTGCTACTTCAGTTCCTGTCATCGTAATCGARGGCGAGAGC[A/T]AGGWRAATCTGCGCCGTCTTTATATTCTCTTATCAAATCAARTGTCTGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa4684
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006439 | Essential Splice Site | 528 | 730 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 51901091)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 48625404 GRCz11 16 48567422 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGGCCTGCTACTTCAGTTCCTGTCATCGTAATCGAGGGCGAGAGCAAGG[T/A]GAATCTGCGCCGTCTTTATATTCTCTTATCAAATCAARTGTCTGGTGCTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Identification of 15 loci influencing height in a Korean population. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: