
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fbp1b
- Ensembl ID:
- ENSDARG00000020364
- ZFIN ID:
- ZDB-GENE-021206-11
- Description:
- fructose-1,6-bisphosphatase 1b [Source:RefSeq peptide;Acc:NP_998297]
- Human Orthologue:
- FBP2
- Human Description:
- fructose-1,6-bisphosphatase 2 [Source:HGNC Symbol;Acc:3607]
- Mouse Orthologue:
- Fbp2
- Mouse Description:
- fructose bisphosphatase 2 Gene [Source:MGI Symbol;Acc:MGI:95491]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7570 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa7570
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000051313 | Missense | 121 | 337 | 3 | 7 |
The following transcripts of ENSDARG00000020364 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 37078570)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 34860519 GRCz11 5 35460672 - KASP Assay ID:
- 554-4156.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTACTTTTTNTTTGTTACCCAGGGCAAATACGTGGTTTGTTTTGACCCTC[T/A]GGATGGCTCTTCAAACATTGACTGCTTAGCGTCTATTGGAACTATTTTTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Identification of 15 loci influencing height in a Korean population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: