
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-260g14.3
- Ensembl ID:
- ENSDARG00000020354
- ZFIN ID:
- ZDB-GENE-041014-332
- Description:
- hypothetical protein LOC558036 [Source:RefSeq peptide;Acc:NP_001020669]
- Human Orthologue:
- LMX1A
- Human Description:
- LIM homeobox transcription factor 1, alpha [Source:HGNC Symbol;Acc:6653]
- Mouse Orthologue:
- Lmx1a
- Mouse Description:
- LIM homeobox transcription factor 1 alpha Gene [Source:MGI Symbol;Acc:MGI:1888519]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9422 | Essential Splice Site | Available for shipment | Available now |
sa32304 | Nonsense | Available for shipment | Available now |
sa37086 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa1653 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa9422
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019059 | Essential Splice Site | 214 | 366 | 4 | 7 |
ENSDART00000139609 | Essential Splice Site | 116 | 147 | 4 | 5 |
ENSDART00000146292 | Essential Splice Site | 116 | 118 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 20 (position 33961261)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 34033774 GRCz11 20 33936653 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCATGAAGGTCAGCCTGTGGCTCAGTCTCTGTCTGTTTGTCTATTGTAA[G/T]GTGAGGGAGACTCTGGCAGCAGAGACAGGACTGAGCGTACGAGTCGTTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32304
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019059 | Nonsense | 227 | 366 | 4 | 7 |
ENSDART00000139609 | Nonsense | 129 | 147 | 4 | 5 |
ENSDART00000146292 | None | 118 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 20 (position 33961301)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 34033814 GRCz11 20 33936693 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTATTGTAAGGTGAGGGAGACTCTGGCAGCAGAGACAGGACTGAGCGTA[C/T]GAGTCGTTCAGGTCTGGTTCCAGAACCAAAGAGCCAAGGTAACGTGATGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37086
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019059 | Nonsense | 232 | 366 | 4 | 7 |
ENSDART00000139609 | Nonsense | 134 | 147 | 4 | 5 |
ENSDART00000146292 | None | 118 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 20 (position 33961318)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 34033831 GRCz11 20 33936710 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGACTCTGGCAGCAGAGACAGGACTGAGCGTACGAGTCGTTCAGGTCTG[G/A]TTCCAGAACCAAAGAGCCAAGGTAACGTGATGCCCGCCGACACAGACAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1653
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019059 | Essential Splice Site | 321 | 366 | 6 | 7 |
ENSDART00000139609 | None | 147 | None | 5 | |
ENSDART00000146292 | None | 118 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 20 (position 33964377)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 34036890 GRCz11 20 33939769 - KASP Assay ID:
- 554-1593.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACAGGGCCTGACCCCTCCTCAGATGCCCGGAGACCACATGCATCCCTATG[G/A]TATTAAATAACACATTATAGACTCACAGCAATGCTGTGCTGGAAATAGGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Response to acetaminophen (hepatotoxicity): Acetaminophen-NAPQI hepatotoxicity: a cell line model system genome-wide association study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: