slc2a8

Ensembl ID:
ENSDARG00000020344
ZFIN ID:
ZDB-GENE-030829-25
Description:
solute carrier family 2, facilitated glucose transporter member 8 [Source:RefSeq peptide;Acc:NP_997
Human Orthologue:
SLC2A8
Human Description:
solute carrier family 2 (facilitated glucose transporter), member 8 [Source:HGNC Symbol;Acc:13812]
Mouse Orthologue:
Slc2a8
Mouse Description:
solute carrier family 2, (facilitated glucose transporter), member 8 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7576 Missense Mutation detected in F1 DNA During 2018
sa18829 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9411 Essential Splice Site Available for shipment Available now
sa20575 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019648 Missense 180 498 4 10
Genomic Location (Zv9):
Chromosome 5 (position 68963287)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65297345
GRCz11 5 65976460
KASP Assay ID:
554-4348.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAGAGGAACTTTGGGATCCTGTGTGCAACTAATGGTTGTGATAGGCATTA[T/G]GGGTGCTTATGTAACAGGTATTGCCTCTCATTTTAAACTTGTGACTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019648 Essential Splice Site 256 498 5 10
ENSDART00000019648 Essential Splice Site 256 498 5 10
Genomic Location (Zv9):
Chromosome 5 (position 68966014)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65300067
GRCz11 5 65979182
KASP Assay ID:
2259-6810.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCGCCGAGTGGGAATGCGCTAGAATAGAAGATGCCTACAAAAATGAAG[T/C]TAGACATCACCAAGTTTTTTGGGTCTTCATTTTATTGAACATAATGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019648 Essential Splice Site 256 498 5 10
ENSDART00000019648 Essential Splice Site 256 498 5 10
Genomic Location (Zv9):
Chromosome 5 (position 68966014)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65300067
GRCz11 5 65979182
KASP Assay ID:
2259-6810.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCGCCGAGTGGGAATGCGCTAGAATAGAAGATGCCTACAAAAATGAAG[T/C]TAGACATCACCAAGTTTTTWGGKTCTTYATTTTATTRAACATAAWGARCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019648 Nonsense 319 498 7 10
Genomic Location (Zv9):
Chromosome 5 (position 68968515)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65302553
GRCz11 5 65981668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTGCCGCAGAGCAGTGATGTGGCCACTGTTATTGTCGCAGCCACA[C/T]AGGTGGTCTTCACTGCAATTGCTGCTCTTATAATGGACAAGGCCGGGCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link