
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-254n4.3
- Ensembl ID:
- ENSDARG00000020292
- ZFIN ID:
- ZDB-GENE-081105-89
- Description:
- family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 [Source:RefSeq peptide;A
- Human Orthologues:
- FAM19A2, FAM19A4, FAM19A5
- Human Descriptions:
- family with sequence similarity 19 (chemokine (C-C motif)-like), member A2 [Source:HGNC Symbol;Acc:2
- family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 [Source:HGNC Symbol;Acc:2
- family with sequence similarity 19 (chemokine (C-C motif)-like), member A5 [Source:HGNC Symbol;Acc:2
- Mouse Orthologues:
- Fam19a2, Fam19a4, Fam19a5
- Mouse Descriptions:
- family with sequence similarity 19, member A2 Gene [Source:MGI Symbol;Acc:MGI:2143691]
- family with sequence similarity 19, member A4 Gene [Source:MGI Symbol;Acc:MGI:2444563]
- family with sequence similarity 19, member A5 Gene [Source:MGI Symbol;Acc:MGI:2146182]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7139 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa8387 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa7139
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000030609 | Nonsense | 27 | 132 | 1 | 4 |
ENSDART00000146132 | Nonsense | 27 | 132 | 2 | 5 |
The following transcripts of ENSDARG00000020292 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 28283234)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 27411152 GRCz11 8 27430291 - KASP Assay ID:
- 554-4837.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCGTGGATCGTACTGGTATTTTTGGCCCTTGTGTTGTTTTGGGGTCATT[T/A]GTCTGAAGCGTCTTCTCACCGCAGTCACATCGGTAAGTCAAGTTCATCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8387
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000030609 | Nonsense | 54 | 132 | 2 | 4 |
ENSDART00000146132 | Nonsense | 54 | 132 | 3 | 5 |
The following transcripts of ENSDARG00000020292 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 28229769)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 27357687 GRCz11 8 27376826 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGCACGTGAAAGCTGGCACATGTGAGGTGATTGCAGCCCATCGCTGCWG[T/A]AACAGAAATAAGATTGAGGAGCGATCGCAGACGGTCAAGTGTTCCTGCTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Pancreatic cancer: Genome-wide association study identifies five loci associated with susceptibility to pancreatic cancer in Chinese populations. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: