si:dkeyp-120h9.1

Ensembl ID:
ENSDARG00000020278
ZFIN ID:
ZDB-GENE-070705-534
Description:
hypothetical protein LOC566469 [Source:RefSeq peptide;Acc:NP_001093492]
Human Orthologues:
SLC7A6, SLC7A7
Human Descriptions:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 [Source:HGNC Symbol;A
solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 [Source:HGNC Symbol;A
Mouse Orthologues:
Slc7a6, Slc7a7
Mouse Descriptions:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 Gene [Source:MGI Symb
solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symb

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3008 Essential Splice Site F2 line generated During 2018
sa36866 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3008
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103636 Essential Splice Site 236 487 4 10
ENSDART00000128391 Essential Splice Site 236 490 4 11
Genomic Location (Zv9):
Chromosome 19 (position 33001392)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32168681
GRCz11 19 31755994
KASP Assay ID:
554-2643.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGGATACCCTGAACTTCATCACAGAGGAGATTAAGAACCCAGAGAGG[T/C]ACAAACATCCATGACATTTTGCTTGATATGATAATAATCTRTTAATAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103636 Essential Splice Site 277 487 5 10
ENSDART00000128391 Essential Splice Site 277 490 5 11
Genomic Location (Zv9):
Chromosome 19 (position 32999807)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32167096
GRCz11 19 31754409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTGCTGGACATGAATACTCTGTTACAGAGTGAAGCCGTGGCTGTGG[T/C]GAGTAAAACTTGGCTTGAAGCTAATCTTTTATCATCGCATCCCAATAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link