DNM2 (2 of 2)

Ensembl ID:
ENSDARG00000020270
Description:
dynamin 2 [Source:HGNC Symbol;Acc:2974]
Human Orthologue:
DNM2
Human Description:
dynamin 2 [Source:HGNC Symbol;Acc:2974]
Mouse Orthologue:
Dnm2
Mouse Description:
dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19634 Nonsense Mutation detected in F1 DNA During 2018
sa7417 Missense Mutation detected in F1 DNA During 2018
sa38304 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100171 Nonsense 25 876 1 26
Genomic Location (Zv9):
Chromosome 1 (position 59722626)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58183161
GRCz11 1 58880164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGATTCCCCTCATTAACAAGCTGCAGGACGCCTTCAGCTCCATCGGC[C/T]AGAGCTGCAACTTGGAGCTGCCGCAGATCGCGGTGGTCGGCGGGCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100171 Missense 86 876 3 26
Genomic Location (Zv9):
Chromosome 1 (position 59714364)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58174899
GRCz11 1 58871902
KASP Assay ID:
554-4294.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATTGTAAACGTGTGTGTGTGTGTGTGTGTGWAGAATATGCMGAGTTCC[T/A]GCACTGTAAGGGCCGCAAGTTTGYGGACTTTGAYGAGGTTCGGATGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100171 Essential Splice Site 383 876 10 26
Genomic Location (Zv9):
Chromosome 1 (position 59708517)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58169052
GRCz11 1 58866055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGAATAAACCGCATCTTCCACGAGCGCTTCCCCTTCGAGCTGGTGAAG[G/A]TGCGCTAACACCGAGCTCTAAATCATCATAAGCTGAAAACGATGATTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link