
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ewsr1a
- Ensembl ID:
- ENSDARG00000020258
- ZFIN ID:
- ZDB-GENE-030131-2317
- Description:
- Ewing sarcoma breakpoint region 1a [Source:RefSeq peptide;Acc:NP_001108610]
- Human Orthologue:
- EWSR1
- Human Description:
- Ewing sarcoma breakpoint region 1 [Source:HGNC Symbol;Acc:3508]
- Mouse Orthologue:
- Ewsr1
- Mouse Description:
- Ewing sarcoma breakpoint region 1 Gene [Source:MGI Symbol;Acc:MGI:99960]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44719 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa15021 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa44719
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024282 | Essential Splice Site | 504 | 626 | None | 16 |
ENSDART00000141445 | None | 325 | None | 10 |
The following transcripts of ENSDARG00000020258 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 7005166)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 8017966 GRCz11 10 7976666 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAATTAATTGCCCAGAGCCTGTTCAATGAGGATTTACTTCTTTTTTTTT[A/G]GTGGATGTGGAAACCAAAACTTTGCCTGGAGAATGGAGTGTAATCAGTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15021
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024282 | Nonsense | 600 | 626 | 15 | 16 |
ENSDART00000141445 | None | 325 | None | 10 |
The following transcripts of ENSDARG00000020258 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 7004794)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 8017594 GRCz11 10 7976294 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GRGGCTTTGGAGGAAGGGGTCGTGGAGGSCCTCCAATGGATGACATGGGC[C/T]GAAGGGGSCGAGGAATGGGACCACCGGGSAAAATGGATATGAAGTGAGTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: