usf2

Ensembl ID:
ENSDARG00000020228
ZFIN ID:
ZDB-GENE-030131-8475
Description:
upstream stimulatory factor 2 [Source:RefSeq peptide;Acc:NP_001116257]
Human Orthologue:
USF2
Human Description:
upstream transcription factor 2, c-fos interacting [Source:HGNC Symbol;Acc:12594]
Mouse Orthologue:
Usf2
Mouse Description:
upstream transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:99961]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36794 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104534 Nonsense 276 329 10 11
ENSDART00000146007 Nonsense 89 142 4 5
ENSDART00000148353 Nonsense 275 328 10 11

The following transcripts of ENSDARG00000020228 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 11190905)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10650134
GRCz11 19 10569059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAAGGAGGCATCCTGTCTAAAGCATGCGACTACATTAGAGAACTTCGA[C/T]AGACCAACCAGAGGCTGCAGGAGAACTACAAGGAGGTGGAGAGAATACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link