
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
usf2
- Ensembl ID:
- ENSDARG00000020228
- ZFIN ID:
- ZDB-GENE-030131-8475
- Description:
- upstream stimulatory factor 2 [Source:RefSeq peptide;Acc:NP_001116257]
- Human Orthologue:
- USF2
- Human Description:
- upstream transcription factor 2, c-fos interacting [Source:HGNC Symbol;Acc:12594]
- Mouse Orthologue:
- Usf2
- Mouse Description:
- upstream transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:99961]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36794 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa36794
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104534 | Nonsense | 276 | 329 | 10 | 11 |
ENSDART00000146007 | Nonsense | 89 | 142 | 4 | 5 |
ENSDART00000148353 | Nonsense | 275 | 328 | 10 | 11 |
The following transcripts of ENSDARG00000020228 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 11190905)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 10650134 GRCz11 19 10569059 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTAAAGGAGGCATCCTGTCTAAAGCATGCGACTACATTAGAGAACTTCGA[C/T]AGACCAACCAGAGGCTGCAGGAGAACTACAAGGAGGTGGAGAGAATACAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: