dld

Ensembl ID:
ENSDARG00000020219
ZFIN ID:
ZDB-GENE-990415-47
Description:
Delta-like protein D [Source:UniProtKB/Swiss-Prot;Acc:Q8UWJ4]
Human Orthologue:
DLL1
Human Description:
delta-like 1 (Drosophila) [Source:HGNC Symbol;Acc:2908]
Mouse Orthologue:
Dll1
Mouse Description:
delta-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104659]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45480 Nonsense Mutation detected in F1 DNA During 2018
sa15390 Nonsense Available for shipment Available now
sa22208 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099224 Nonsense 35 717 2 11
Genomic Location (Zv9):
Chromosome 13 (position 5758651)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5952676
GRCz11 13 6081136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTCAGGGGTTTTTGAGCTAAAGTTGCAGGAGTTTCTGAACAAGAAA[G/T]GAGTGACAGGCAACGCAAACTGCTGCAAGGGATCCGCGGCAGAGGGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099224 Nonsense 630 717 9 11
Genomic Location (Zv9):
Chromosome 13 (position 5754253)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5948278
GRCz11 13 6076738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAAACATCAACAAGAARGTRGACTTTCAGAGCGACGGCGAMAAAAAC[G/T]GATTCAARTCGCGATACTCGCTAGTGGATTACAATCTTKTTCATGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099224 Nonsense 679 717 9 11
Genomic Location (Zv9):
Chromosome 13 (position 5754105)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5948130
GRCz11 13 6076590
KASP Assay ID:
2260-5986.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGCGAGCCTCTCGATTCCGACTCAGAGGAGAAGCACAGAAATCATT[T/G]AAAAAGGTAAATGAGTGTGAATTTTGGCTAGCGCAGATCCATTTGTCGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link