
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nar
- Ensembl ID:
- ENSDARG00000020217
- ZFIN ID:
- ZDB-GENE-990415-180
- Description:
- cleavage and polyadenylation specificity factor subunit 4 [Source:RefSeq peptide;Acc:NP_571084]
- Human Orthologue:
- CPSF4
- Human Description:
- cleavage and polyadenylation specific factor 4, 30kDa [Source:HGNC Symbol;Acc:2327]
- Mouse Orthologue:
- Cpsf4
- Mouse Description:
- cleavage and polyadenylation specific factor 4 Gene [Source:MGI Symbol;Acc:MGI:1861602]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20096 | Essential Splice Site | Available for shipment | Available now |
sa760 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa20096
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017304 | Essential Splice Site | 102 | 271 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 3 (position 40285003)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 40148363 GRCz11 3 40290221 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGAGTACGACATGACTAAGATGCCCGAGTGTTATTTCTACTCTAAATTTG[G/A]TTAGTATTGTAATATCCATCCATCCATCTATATTTTGTTTGTTAATAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa760
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000017304 | Essential Splice Site | 135 | 271 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 3 (position 40285179)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 40148539 GRCz11 3 40290397 - KASP Assay ID:
- 554-0666.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTAAGATTAAAGATTGCCCGTGGTATGATAGGGGTTTTTGTAAACATGG[T/A]AAGTCTTTTGCTATAATTTCCAGATATTGACATACATATACATTCATACG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: